Incidental Mutation 'R3804:Top1'
ID274477
Institutional Source Beutler Lab
Gene Symbol Top1
Ensembl Gene ENSMUSG00000070544
Gene Nametopoisomerase (DNA) I
SynonymsD130064I21Rik, Top-1
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3804 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160645888-160722764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160702768 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 268 (H268R)
Ref Sequence ENSEMBL: ENSMUSP00000105094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109468]
Predicted Effect probably damaging
Transcript: ENSMUST00000109468
AA Change: H268R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: H268R

DomainStartEndE-ValueType
low complexity region 20 95 N/A INTRINSIC
low complexity region 150 211 N/A INTRINSIC
Blast:TOPEUc 245 321 9e-19 BLAST
low complexity region 323 339 N/A INTRINSIC
TOPEUc 362 739 4.43e-280 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164510
Meta Mutation Damage Score 0.3499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Top1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Top1 APN 2 160704973 splice site probably null
IGL03083:Top1 APN 2 160703578 missense probably damaging 0.97
IGL03242:Top1 APN 2 160715733 missense probably damaging 1.00
IGL03369:Top1 APN 2 160693727 missense unknown
R0022:Top1 UTSW 2 160702799 missense possibly damaging 0.62
R0449:Top1 UTSW 2 160712708 nonsense probably null
R0501:Top1 UTSW 2 160714159 missense probably damaging 1.00
R0564:Top1 UTSW 2 160714265 missense probably damaging 0.98
R0946:Top1 UTSW 2 160712668 nonsense probably null
R0972:Top1 UTSW 2 160721025 missense probably damaging 1.00
R0976:Top1 UTSW 2 160717423 missense possibly damaging 0.86
R1534:Top1 UTSW 2 160714232 missense probably damaging 1.00
R1608:Top1 UTSW 2 160703595 missense probably benign 0.01
R1655:Top1 UTSW 2 160703696 critical splice donor site probably null
R1818:Top1 UTSW 2 160715723 missense probably damaging 1.00
R1937:Top1 UTSW 2 160670122 missense unknown
R2055:Top1 UTSW 2 160702828 splice site probably benign
R2104:Top1 UTSW 2 160704819 missense probably damaging 1.00
R3705:Top1 UTSW 2 160702824 critical splice donor site probably null
R3769:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3770:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3801:Top1 UTSW 2 160702768 missense probably damaging 1.00
R3928:Top1 UTSW 2 160687749 splice site probably benign
R4598:Top1 UTSW 2 160720965 missense possibly damaging 0.89
R4651:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4652:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4742:Top1 UTSW 2 160703570 critical splice acceptor site probably null
R5523:Top1 UTSW 2 160702775 nonsense probably null
R6292:Top1 UTSW 2 160698141 missense probably benign 0.19
R6724:Top1 UTSW 2 160712696 missense probably damaging 1.00
R7354:Top1 UTSW 2 160704958 missense probably damaging 1.00
R7461:Top1 UTSW 2 160712842 intron probably null
R7843:Top1 UTSW 2 160714256 missense possibly damaging 0.90
R7855:Top1 UTSW 2 160714088 missense probably damaging 1.00
R8100:Top1 UTSW 2 160698235 nonsense probably null
R8302:Top1 UTSW 2 160703576 missense probably damaging 1.00
R8377:Top1 UTSW 2 160646089 start gained probably benign
R8380:Top1 UTSW 2 160717395 missense probably benign 0.00
R8381:Top1 UTSW 2 160703674 missense probably null 0.77
R8392:Top1 UTSW 2 160717454 nonsense probably null
X0027:Top1 UTSW 2 160721518 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGGAAAGGTGAGCCATC -3'
(R):5'- GCAGTCACATGAAAGCTGAG -3'

Sequencing Primer
(F):5'- GTGAGCCATCAGTCATGACCTC -3'
(R):5'- AGCTGAGAAGGGATATATTCTTGTTG -3'
Posted On2015-04-02