Incidental Mutation 'R3811:Spem2'
ID275202
Institutional Source Beutler Lab
Gene Symbol Spem2
Ensembl Gene ENSMUSG00000044084
Gene NameSPEM family member 2
Synonyms4933402P03Rik
MMRRC Submission 040767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3811 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69816566-69818465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69817164 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 325 (E325G)
Ref Sequence ENSEMBL: ENSMUSP00000051204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045771] [ENSMUST00000056941] [ENSMUST00000210714]
Predicted Effect probably benign
Transcript: ENSMUST00000045771
SMART Domains Protein: ENSMUSP00000037500
Gene: ENSMUSG00000041165

DomainStartEndE-ValueType
Pfam:Spem1 12 196 3.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056941
AA Change: E325G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051204
Gene: ENSMUSG00000044084
AA Change: E325G

DomainStartEndE-ValueType
Pfam:Spem1 1 261 2e-121 PFAM
low complexity region 281 294 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210714
Meta Mutation Damage Score 0.1487 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 G T 6: 34,799,729 S385I probably damaging Het
Arhgap28 G A 17: 67,896,093 P122S probably benign Het
Arid2 T C 15: 96,289,086 V73A probably benign Het
Atp1b1 C T 1: 164,443,305 R35H probably benign Het
Cacybp T C 1: 160,203,652 D202G probably benign Het
Chsy3 C G 18: 59,176,170 P165R probably benign Het
Creb3 C T 4: 43,565,501 Q227* probably null Het
Crnkl1 C A 2: 145,931,306 R140L probably damaging Het
Cyth4 A G 15: 78,604,649 E39G probably damaging Het
Dnah6 T C 6: 73,191,498 T481A probably benign Het
Dock4 T A 12: 40,779,124 I1003N possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Glrx5 C G 12: 105,032,888 C63W probably damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Hivep2 A G 10: 14,130,357 T900A probably benign Het
Hmcn1 A G 1: 150,649,577 probably null Het
Ighv1-24 G T 12: 114,773,065 L72I probably benign Het
Ilvbl G A 10: 78,579,035 C244Y probably benign Het
Kat7 A G 11: 95,291,615 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lamc1 A T 1: 153,262,708 probably null Het
Mall T A 2: 127,708,854 I129F probably damaging Het
Mdn1 A T 4: 32,693,506 K1044* probably null Het
Med23 A T 10: 24,892,592 R77* probably null Het
Med23 G A 10: 24,892,593 probably null Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Olfr1066 A T 2: 86,455,347 V308E probably benign Het
Psmd1 T A 1: 86,132,715 V828D probably damaging Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rbbp5 T C 1: 132,492,587 V59A probably damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Slc32a1 G T 2: 158,614,736 C437F possibly damaging Het
Steap4 A G 5: 7,977,017 T327A probably benign Het
Tsc2 T C 17: 24,629,037 D70G probably benign Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Other mutations in Spem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Spem2 APN 11 69817239 missense possibly damaging 0.53
IGL02208:Spem2 APN 11 69817263 unclassified probably null
IGL02315:Spem2 APN 11 69817365 missense probably damaging 0.98
IGL02325:Spem2 APN 11 69816963 missense probably benign 0.00
IGL02877:Spem2 APN 11 69817695 missense probably benign 0.16
R1476:Spem2 UTSW 11 69818070 missense probably benign 0.05
R1928:Spem2 UTSW 11 69817464 missense probably benign 0.03
R3741:Spem2 UTSW 11 69816730 missense possibly damaging 0.53
R4271:Spem2 UTSW 11 69817425 missense probably damaging 0.98
R4717:Spem2 UTSW 11 69817783 missense probably benign 0.37
R4997:Spem2 UTSW 11 69817732 missense probably benign 0.06
R5114:Spem2 UTSW 11 69817147 missense probably benign 0.33
R6137:Spem2 UTSW 11 69816696 nonsense probably null
R6302:Spem2 UTSW 11 69818265 missense possibly damaging 0.71
R6454:Spem2 UTSW 11 69817428 missense probably damaging 0.97
R6923:Spem2 UTSW 11 69817777 missense probably damaging 0.99
R7000:Spem2 UTSW 11 69817756 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCGGACTTCGTGAGATTC -3'
(R):5'- TTGCCTAAGCGAGTAGAGGC -3'

Sequencing Primer
(F):5'- TGAGATTCCCGGGAGCTGTAAC -3'
(R):5'- ATTATTCACAGTCCCGGATTTGG -3'
Posted On2015-04-02