Incidental Mutation 'R3858:Slc4a1'
ID 276259
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Name solute carrier family 4 (anion exchanger), member 1
Synonyms band 3, CD233, Ae1, erythrocyte membrane protein band 3, l11Jus51, Empb3
MMRRC Submission 040786-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3858 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 102239646-102256107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102247947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 349 (V349E)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
AlphaFold P04919
Predicted Effect probably benign
Transcript: ENSMUST00000006749
AA Change: V349E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: V349E

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151050
Meta Mutation Damage Score 0.1990 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,863,581 (GRCm39) S179T probably benign Het
Ahnak A G 19: 8,988,223 (GRCm39) E3169G possibly damaging Het
Ccdc82 G A 9: 13,251,704 (GRCm39) probably benign Het
Ccng1 A G 11: 40,644,660 (GRCm39) L79P probably damaging Het
Cd2ap G A 17: 43,127,463 (GRCm39) Q377* probably null Het
Celf1 A G 2: 90,843,086 (GRCm39) E411G probably damaging Het
Cemip2 A G 19: 21,829,598 (GRCm39) T1236A probably benign Het
Cps1 A G 1: 67,207,437 (GRCm39) Y582C probably damaging Het
Efhb A G 17: 53,769,808 (GRCm39) L167S possibly damaging Het
Erc2 A G 14: 28,197,599 (GRCm39) probably benign Het
Hs3st1 G A 5: 39,772,256 (GRCm39) T129I probably damaging Het
Irs4 T C X: 140,507,059 (GRCm39) E379G probably damaging Het
Kcnmb2 T C 3: 32,252,450 (GRCm39) V217A probably damaging Het
Megf10 T C 18: 57,408,907 (GRCm39) probably benign Het
Mib1 T A 18: 10,798,409 (GRCm39) C757S possibly damaging Het
Mtmr4 G A 11: 87,488,088 (GRCm39) V24M probably damaging Het
Obscn A G 11: 58,971,795 (GRCm39) probably benign Het
Or12d13 A T 17: 37,648,117 (GRCm39) L2* probably null Het
Or5b119 T A 19: 13,457,494 (GRCm39) I23F possibly damaging Het
Pirb T C 7: 3,720,662 (GRCm39) K279E possibly damaging Het
Pmp22 T C 11: 63,025,301 (GRCm39) S45P probably benign Het
Pth2r A T 1: 65,361,206 (GRCm39) I52F probably damaging Het
Reck A G 4: 43,930,261 (GRCm39) T612A probably benign Het
Rtn4rl2 A G 2: 84,710,730 (GRCm39) probably null Het
Sis A G 3: 72,835,985 (GRCm39) I868T probably damaging Het
Slc23a3 A G 1: 75,106,040 (GRCm39) probably null Het
Thsd7a C T 6: 12,555,225 (GRCm39) G220S probably benign Het
Tle4 G A 19: 14,445,577 (GRCm39) T223I probably benign Het
Tor3a T A 1: 156,497,124 (GRCm39) L140F probably damaging Het
Vcf2 T C X: 149,203,357 (GRCm39) Q39R probably benign Het
Vmn2r86 A G 10: 130,291,594 (GRCm39) M57T probably benign Het
Zfp512 G T 5: 31,630,184 (GRCm39) R222L probably damaging Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102,248,790 (GRCm39) missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102,244,729 (GRCm39) missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102,245,159 (GRCm39) missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102,247,093 (GRCm39) missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102,249,972 (GRCm39) critical splice acceptor site probably null
Rumor UTSW 11 102,252,048 (GRCm39) nonsense probably null
A5278:Slc4a1 UTSW 11 102,244,641 (GRCm39) splice site probably benign
R0011:Slc4a1 UTSW 11 102,247,936 (GRCm39) missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102,243,510 (GRCm39) missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102,245,192 (GRCm39) missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102,248,741 (GRCm39) splice site probably benign
R0635:Slc4a1 UTSW 11 102,243,498 (GRCm39) missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102,251,997 (GRCm39) missense probably benign
R1816:Slc4a1 UTSW 11 102,242,056 (GRCm39) missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102,241,133 (GRCm39) missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102,247,656 (GRCm39) missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102,250,128 (GRCm39) missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102,248,019 (GRCm39) missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102,242,329 (GRCm39) missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102,244,087 (GRCm39) missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102,252,209 (GRCm39) missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102,249,903 (GRCm39) missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102,249,080 (GRCm39) missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102,241,140 (GRCm39) missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102,244,092 (GRCm39) missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102,247,351 (GRCm39) missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102,243,357 (GRCm39) missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102,247,561 (GRCm39) missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102,252,048 (GRCm39) nonsense probably null
R6717:Slc4a1 UTSW 11 102,245,249 (GRCm39) missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102,244,693 (GRCm39) missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102,247,310 (GRCm39) missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102,252,245 (GRCm39) start gained probably benign
R7582:Slc4a1 UTSW 11 102,243,403 (GRCm39) missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102,244,083 (GRCm39) missense possibly damaging 0.94
R9036:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R9274:Slc4a1 UTSW 11 102,242,047 (GRCm39) missense probably benign 0.00
R9502:Slc4a1 UTSW 11 102,247,674 (GRCm39) missense probably damaging 0.97
R9568:Slc4a1 UTSW 11 102,247,680 (GRCm39) missense probably damaging 1.00
R9585:Slc4a1 UTSW 11 102,247,915 (GRCm39) missense probably benign 0.08
R9651:Slc4a1 UTSW 11 102,242,256 (GRCm39) missense probably damaging 1.00
RF006:Slc4a1 UTSW 11 102,247,542 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATCAGGCCTCCAAAGATCC -3'
(R):5'- TGGCTACAGAGTAAGTGTTCG -3'

Sequencing Primer
(F):5'- CCCCGTTCAAGTCTGTTGTAGAG -3'
(R):5'- CTACAGAGTAAGTGTTCGTGACC -3'
Posted On 2015-04-06