Incidental Mutation 'R6717:Slc4a1'

• ID: 529448
• Institutional Source: Beutler Lab
• Gene Symbol: Slc4a1
• Ensembl Gene: ENSMUSG00000006574
• Gene Name: solute carrier family 4 (anion exchanger), member 1
• Synonyms: Ae1, CD233, l11Jus51, band 3, Empb3, erythrocyte membrane protein band 3
• Accession Numbers:

  Genbank: NM_011403; MGI: 109393

• Essential gene?: Essential (E-score: 1.000)
• Stock #: R6717 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 11
• Chromosomal Location: 102348824-102366203 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to C at 102354423 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Tyrosine to Cysteine at position 566 (Y566C)
• Ref Sequence: ENSEMBL: ENSMUSP00000006749
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000006749]
• AlphaFold: P04919
• Predicted Effect: probably damaging; Transcript: ENSMUST00000006749; AA Change: Y566C; PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
• SMART Domains: Protein: ENSMUSP00000006749; Gene: ENSMUSG00000006574; AA Change: Y566C

Domain	Start	End	E-Value	Type
low complexity region	58	68	N/A	INTRINSIC
Pfam:Band_3_cyto	100	342	1.6e-81	PFAM
Pfam:HCO3_cotransp	391	584	5.7e-85	PFAM
Pfam:HCO3_cotransp	575	857	5.6e-118	PFAM
transmembrane domain	875	892	N/A	INTRINSIC

• Predicted Effect: noncoding transcript; Transcript: ENSMUST00000149993
• Meta Mutation Damage Score: 0.6467
• Coding Region Coverage:
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
• Validation Efficiency: 98% (47/48)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
• Allele List at MGI:

  All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

• Posted On: 2018-08-01

Predicted Primers

PCR Primer
(F):5'- GGTATACTGACCTTGCCAGGG -3'
(R):5'- CCCAAGTAGGTTAATAAATCAGATGAG -3'

Sequencing Primer
(F):5'- TATACTGACCTTGCCAGGGAAGTAG -3'
(R):5'- CAGATGGATGGATGGATGGATG -3'