Incidental Mutation 'R3936:Mcm2'
ID307169
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Nameminichromosome maintenance complex component 2
SynonymsBM28, CDCL1, Mcmd2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88883474-88898780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88893008 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 60 (R60C)
Ref Sequence ENSEMBL: ENSMUSP00000145295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058011
AA Change: R204C

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: R204C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably damaging
Transcript: ENSMUST00000205165
AA Change: R60C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870
AA Change: R60C

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Meta Mutation Damage Score 0.1633 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 probably null Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88893401 missense probably benign 0.04
IGL01082:Mcm2 APN 6 88887877 missense probably benign 0.05
IGL01451:Mcm2 APN 6 88891966 splice site probably benign
IGL01534:Mcm2 APN 6 88887718 critical splice donor site probably null
IGL01670:Mcm2 APN 6 88887632 unclassified probably benign
IGL01724:Mcm2 APN 6 88886062 missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88891726 missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88888236 nonsense probably null
R0254:Mcm2 UTSW 6 88884016 missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88892078 missense probably benign 0.12
R1740:Mcm2 UTSW 6 88884044 missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88889788 missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88891803 missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88888252 missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88887804 missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88891991 missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88897450 missense probably benign
R5701:Mcm2 UTSW 6 88893091 missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88884071 missense probably benign 0.05
R6118:Mcm2 UTSW 6 88887836 missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88889909 critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88885862 missense probably benign 0.00
R6550:Mcm2 UTSW 6 88886959 critical splice donor site probably null
R7184:Mcm2 UTSW 6 88891794 missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88887946 missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88892057 missense probably damaging 1.00
R8215:Mcm2 UTSW 6 88897311 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTCTGAGTTCAGTGCGGCAC -3'
(R):5'- TTGCTACCCAAGACAGCAGC -3'

Sequencing Primer
(F):5'- GCCAGCAGGATACAGAAGCC -3'
(R):5'- CCAAGACAGCAGCGAGGAAG -3'
Posted On2015-04-17