Incidental Mutation 'R3936:Sorcs3'

• ID: 307194
• Institutional Source: Beutler Lab
• Gene Symbol: Sorcs3
• Ensembl Gene: ENSMUSG00000063434
• Gene Name: sortilin-related VPS10 domain containing receptor 3
• Synonyms: 6330404A12Rik
• Essential gene?: Probably non essential (E-score: 0.142)
• Stock #: R3936 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 19
• Chromosomal Location: 48206025-48805505 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to A at 48713504 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Valine to Aspartic acid at position 608 (V608D)
• Ref Sequence: ENSEMBL: ENSMUSP00000077919
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000078880]
• AlphaFold: Q8VI51
• Predicted Effect: probably damaging; Transcript: ENSMUST00000078880; AA Change: V608D; PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
• SMART Domains: Protein: ENSMUSP00000077919; Gene: ENSMUSG00000063434; AA Change: V608D

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

• Meta Mutation Damage Score: 0.8006
• Coding Region Coverage:
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
• Posted On: 2015-04-17

Predicted Primers

PCR Primer
(F):5'- CCTACGAATGCCATTTGAGTGG -3'
(R):5'- TTAAGAAAACAGTGTGCTGGTG -3'

Sequencing Primer
(F):5'- AGAGCATCTGTTCTCTGTAAGTC -3'
(R):5'- CAGTGTGCTGGTGAGGAAATG -3'