Incidental Mutation 'R3936:Sorcs3'
ID 307194
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R3936 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 48206025-48805505 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48713504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 608 (V608D)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect probably damaging
Transcript: ENSMUST00000078880
AA Change: V608D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: V608D

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.8006 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 (GRCm38) T1547M possibly damaging Het
Alk T A 17: 72,205,954 (GRCm38) I337F probably damaging Het
Ank3 A T 10: 69,879,989 (GRCm38) K491* probably null Het
Arx T A X: 93,297,369 (GRCm38) L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 (GRCm38) N203S probably benign Het
Baz2b A G 2: 59,912,761 (GRCm38) V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 (GRCm38) H4L probably benign Het
Dync2h1 C A 9: 7,001,482 (GRCm38) L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 (GRCm38) F133L probably benign Het
Fnip1 A G 11: 54,480,239 (GRCm38) probably null Het
G6pc A G 11: 101,374,603 (GRCm38) I154V probably benign Het
Golgb1 G T 16: 36,914,056 (GRCm38) E1222* probably null Het
Gpr85 A G 6: 13,836,045 (GRCm38) F287L probably benign Het
Gzmk A T 13: 113,173,025 (GRCm38) S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 (GRCm38) S156R probably benign Het
Kansl1 A T 11: 104,343,543 (GRCm38) D712E possibly damaging Het
Mc3r T A 2: 172,249,296 (GRCm38) I146N probably damaging Het
Mcm2 G A 6: 88,893,008 (GRCm38) R60C probably damaging Het
Mitf C T 6: 97,993,253 (GRCm38) P54S probably damaging Het
Olfr156 T A 4: 43,821,359 (GRCm38) M1L probably benign Het
P4hb A C 11: 120,562,409 (GRCm38) H440Q probably benign Het
Pbsn T C X: 77,848,096 (GRCm38) T32A probably damaging Het
Rptn A C 3: 93,395,576 (GRCm38) H72P possibly damaging Het
Scn1a T C 2: 66,327,776 (GRCm38) I418V probably damaging Het
Sf3a1 T A 11: 4,180,024 (GRCm38) probably null Het
Slc35f1 C T 10: 53,108,218 (GRCm38) T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 (GRCm38) probably benign Het
Sult2b1 C T 7: 45,742,216 (GRCm38) V49M probably benign Het
Tlr11 A G 14: 50,362,735 (GRCm38) E726G possibly damaging Het
Treh C T 9: 44,684,543 (GRCm38) R342W probably benign Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,683,658 (GRCm38) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,748,319 (GRCm38) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,603,864 (GRCm38) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,767,103 (GRCm38) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,796,375 (GRCm38) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,790,131 (GRCm38) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,794,168 (GRCm38) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,535,531 (GRCm38) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,654,072 (GRCm38) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,704,370 (GRCm38) splice site probably benign
IGL02830:Sorcs3 APN 19 48,723,002 (GRCm38) splice site probably null
IGL02943:Sorcs3 APN 19 48,759,938 (GRCm38) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,603,894 (GRCm38) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,654,044 (GRCm38) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,748,319 (GRCm38) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,797,517 (GRCm38) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,802,698 (GRCm38) nonsense probably null
R0646:Sorcs3 UTSW 19 48,206,295 (GRCm38) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,487,406 (GRCm38) missense probably benign
R0792:Sorcs3 UTSW 19 48,706,009 (GRCm38) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,693,994 (GRCm38) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,487,394 (GRCm38) missense probably benign
R1253:Sorcs3 UTSW 19 48,206,736 (GRCm38) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,694,001 (GRCm38) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,706,009 (GRCm38) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,764,181 (GRCm38) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,748,359 (GRCm38) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,603,875 (GRCm38) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,794,274 (GRCm38) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,722,925 (GRCm38) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,398,711 (GRCm38) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,603,904 (GRCm38) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,722,956 (GRCm38) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,713,504 (GRCm38) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,749,373 (GRCm38) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,693,914 (GRCm38) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,683,597 (GRCm38) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,794,163 (GRCm38) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,398,744 (GRCm38) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,398,744 (GRCm38) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,764,148 (GRCm38) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,759,951 (GRCm38) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,759,845 (GRCm38) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,796,472 (GRCm38) splice site probably null
R5848:Sorcs3 UTSW 19 48,788,511 (GRCm38) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,749,396 (GRCm38) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,796,450 (GRCm38) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,398,697 (GRCm38) missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48,759,857 (GRCm38) missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48,790,166 (GRCm38) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,802,759 (GRCm38) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,764,307 (GRCm38) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,788,505 (GRCm38) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,713,571 (GRCm38) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,693,824 (GRCm38) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,749,343 (GRCm38) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,705,963 (GRCm38) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,772,266 (GRCm38) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,764,295 (GRCm38) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,764,295 (GRCm38) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,206,474 (GRCm38) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,704,369 (GRCm38) splice site probably null
R8433:Sorcs3 UTSW 19 48,206,474 (GRCm38) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,206,474 (GRCm38) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,206,474 (GRCm38) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,796,469 (GRCm38) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,749,371 (GRCm38) nonsense probably null
R9051:Sorcs3 UTSW 19 48,206,370 (GRCm38) missense probably benign
R9119:Sorcs3 UTSW 19 48,653,994 (GRCm38) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,796,372 (GRCm38) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,797,511 (GRCm38) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,722,925 (GRCm38) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,722,925 (GRCm38) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,722,924 (GRCm38) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,772,289 (GRCm38) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,645,804 (GRCm38) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,704,300 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACGAATGCCATTTGAGTGG -3'
(R):5'- TTAAGAAAACAGTGTGCTGGTG -3'

Sequencing Primer
(F):5'- AGAGCATCTGTTCTCTGTAAGTC -3'
(R):5'- CAGTGTGCTGGTGAGGAAATG -3'
Posted On 2015-04-17