Mutagenetix > Incidental Mutation

Incidental Mutation 'R0377:Tnfsf11'

30822

Institutional Source

Beutler Lab

Gene Symbol

Tnfsf11

Ensembl Gene

ENSMUSG00000022015

Gene Name

tumor necrosis factor (ligand) superfamily, member 11

Synonyms

Ly109l, Trance, osteoclast differentiation factor, RANKL, OPGL, OPGL, ODF

MMRRC Submission

038583-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.478) question?

Stock #

R0377 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78514886-78545483 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 78537352 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 104 (T104P)

Ref Sequence

ENSEMBL: ENSMUSP00000022592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022592]

AlphaFold

O35235

PDB Structure

CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MOUSE RANK LIGAND [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TRANCE/RANKL CYTOKINE. [X-RAY DIFFRACTION]
Mouse RANKL Structure at 1.9A Resolution [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000022592
AA Change: T104P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000022592
Gene: ENSMUSG00000022015
AA Change: T104P

Domain	Start	End	E-Value	Type
low complexity region	32	46	N/A	INTRINSIC
transmembrane domain	49	71	N/A	INTRINSIC
TNF	163	312	7.37e-58	SMART

Meta Mutation Damage Score

0.0632

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.8%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a failure of tooth eruption, osteopetrosis, failure to lactate and arrested alveolar bud differentiation during pregnancy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	C	A	11: 94,265,922 (GRCm39)	V107F	possibly damaging	Het
Acad11	T	A	9: 103,958,891 (GRCm39)		probably benign	Het
Ache	G	A	5: 137,289,190 (GRCm39)	E299K	possibly damaging	Het
Adam5	T	C	8: 25,237,557 (GRCm39)	T618A	probably benign	Het
Amigo2	T	A	15: 97,144,261 (GRCm39)	T54S	possibly damaging	Het
Anapc1	A	G	2: 128,483,260 (GRCm39)		probably null	Het
Btaf1	A	G	19: 36,966,402 (GRCm39)	K1057E	probably benign	Het
Cep55	T	A	19: 38,060,337 (GRCm39)	L396*	probably null	Het
Cic	C	A	7: 24,985,224 (GRCm39)	H1157N	probably damaging	Het
Cntnap5a	A	T	1: 116,220,259 (GRCm39)	T690S	probably benign	Het
D5Ertd579e	A	T	5: 36,761,911 (GRCm39)	C1319S	probably benign	Het
Dnah6	A	G	6: 73,098,975 (GRCm39)	S2027P	possibly damaging	Het
Dnai4	A	G	4: 102,905,456 (GRCm39)	V775A	probably damaging	Het
Dntt	G	A	19: 41,036,066 (GRCm39)	W369*	probably null	Het
Esp18	T	A	17: 39,720,835 (GRCm39)	W27R	probably benign	Het
Fam227b	A	T	2: 125,966,920 (GRCm39)		probably benign	Het
Fbxo31	G	A	8: 122,285,841 (GRCm39)		probably benign	Het
Gm13547	G	A	2: 29,651,803 (GRCm39)		probably null	Het
Gnl2	T	A	4: 124,940,175 (GRCm39)		probably benign	Het
Gpx2	G	A	12: 76,841,930 (GRCm39)	Q74*	probably null	Het
Gucy2c	A	G	6: 136,727,915 (GRCm39)		probably null	Het
Hoxa5	A	T	6: 52,179,626 (GRCm39)	W250R	probably damaging	Het
Izumo4	G	A	10: 80,538,674 (GRCm39)	R42H	probably damaging	Het
Kcnj12	G	A	11: 60,960,222 (GRCm39)	M71I	probably benign	Het
Kmt2b	A	T	7: 30,273,618 (GRCm39)	L2333Q	probably damaging	Het
Mak	T	C	13: 41,202,824 (GRCm39)	E177G	probably damaging	Het
Map3k7	T	A	4: 31,985,731 (GRCm39)	I218N	probably damaging	Het
Mark3	T	C	12: 111,595,463 (GRCm39)	L393P	probably damaging	Het
Msh4	A	G	3: 153,602,527 (GRCm39)	S234P	probably benign	Het
Mug1	A	G	6: 121,834,320 (GRCm39)	D367G	probably benign	Het
Mypn	A	G	10: 62,963,401 (GRCm39)		probably benign	Het
Ncapg	T	C	5: 45,851,159 (GRCm39)	V784A	probably benign	Het
Nutf2	T	A	8: 106,605,504 (GRCm39)	V113D	probably damaging	Het
Odad2	G	A	18: 7,127,415 (GRCm39)	R933C	probably benign	Het
Opn3	T	C	1: 175,491,260 (GRCm39)	M258V	probably damaging	Het
Or8k33	A	T	2: 86,383,927 (GRCm39)	D180E	probably damaging	Het
Osbpl7	A	G	11: 96,946,760 (GRCm39)	D211G	probably damaging	Het
Pcnx1	C	T	12: 82,021,353 (GRCm39)		probably benign	Het
Plekhd1	G	A	12: 80,753,210 (GRCm39)		probably benign	Het
Pnpla6	A	G	8: 3,591,501 (GRCm39)	E1165G	probably damaging	Het
Prkab2	T	A	3: 97,569,633 (GRCm39)	D66E	probably benign	Het
Prpsap2	A	G	11: 61,631,826 (GRCm39)	I177T	possibly damaging	Het
Ptpn23	A	T	9: 110,217,200 (GRCm39)	S885R	possibly damaging	Het
Rab26	A	T	17: 24,749,019 (GRCm39)		probably benign	Het
Rab5a	G	A	17: 53,807,490 (GRCm39)	M175I	probably benign	Het
Rassf9	T	A	10: 102,381,510 (GRCm39)	D297E	probably benign	Het
Rimbp2	C	T	5: 128,880,925 (GRCm39)	R161Q	probably damaging	Het
Rtp1	A	G	16: 23,250,034 (GRCm39)	Y133C	probably damaging	Het
Sdr16c5	G	A	4: 4,005,546 (GRCm39)	L263F	probably benign	Het
Sec14l1	T	G	11: 117,039,966 (GRCm39)		probably benign	Het
Snrnp40	C	G	4: 130,271,836 (GRCm39)		probably null	Het
Spaca1	T	C	4: 34,044,267 (GRCm39)		probably null	Het
Stk36	C	T	1: 74,651,889 (GRCm39)	P394L	probably benign	Het
Stk4	T	C	2: 163,938,720 (GRCm39)	I196T	probably damaging	Het
Sult1b1	A	T	5: 87,665,235 (GRCm39)	M233K	probably damaging	Het
Tmem8b	C	T	4: 43,674,005 (GRCm39)	T212M	probably damaging	Het
Tmprss11g	A	T	5: 86,638,610 (GRCm39)	F293I	probably damaging	Het
Trmt2a	G	A	16: 18,067,567 (GRCm39)	R80Q	possibly damaging	Het
Trps1	C	A	15: 50,695,174 (GRCm39)	E324*	probably null	Het
U2surp	C	T	9: 95,366,496 (GRCm39)	V470I	probably benign	Het
Wdr18	G	A	10: 79,803,336 (GRCm39)	R400H	probably benign	Het
Zfp119b	T	A	17: 56,245,671 (GRCm39)	H505L	probably damaging	Het
Zfp619	T	A	7: 39,186,221 (GRCm39)	C750*	probably null	Het
Zfr	T	C	15: 12,160,677 (GRCm39)	I750T	probably benign	Het

Other mutations in Tnfsf11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02601:Tnfsf11	APN	14	78,537,385 (GRCm39)	nonsense	probably null
R0352:Tnfsf11	UTSW	14	78,516,408 (GRCm39)	missense	probably benign	0.17
R2062:Tnfsf11	UTSW	14	78,516,362 (GRCm39)	missense	probably damaging	1.00
R2121:Tnfsf11	UTSW	14	78,537,333 (GRCm39)	missense	probably benign	0.32
R2178:Tnfsf11	UTSW	14	78,521,682 (GRCm39)	missense	probably benign	0.00
R2237:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2238:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2239:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2430:Tnfsf11	UTSW	14	78,521,752 (GRCm39)	missense	probably benign	0.00
R4155:Tnfsf11	UTSW	14	78,537,309 (GRCm39)	missense	probably benign	0.28
R4197:Tnfsf11	UTSW	14	78,521,752 (GRCm39)	missense	probably benign	0.00
R4562:Tnfsf11	UTSW	14	78,516,020 (GRCm39)	missense	probably damaging	1.00
R6141:Tnfsf11	UTSW	14	78,545,299 (GRCm39)	missense	probably damaging	0.99
R8063:Tnfsf11	UTSW	14	78,516,098 (GRCm39)	missense	probably damaging	1.00
R8904:Tnfsf11	UTSW	14	78,516,119 (GRCm39)	missense	possibly damaging	0.88
X0020:Tnfsf11	UTSW	14	78,516,317 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCTTCACAAGCCTTAACATTCAGTT -3'
(R):5'- GCACAGGTGTTCATACCCATTCACA -3'

Sequencing Primer
(F):5'- GTTACTGTAGCATCATCAAGACC -3'
(R):5'- accgacctgcttctgcc -3'

Posted On

2013-04-24