Incidental Mutation 'R3883:Tap1'
ID308843
Institutional Source Beutler Lab
Gene Symbol Tap1
Ensembl Gene ENSMUSG00000037321
Gene Nametransporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
SynonymsABC transporter, MHC, 1; ABC17; antigen peptide transporter (APT1); ATP-binding cassette, subfamily B, member 2 (Abcb2); ATP-binding cassette, sub-family B (MDR/TAP), member 2; ATP-binding cassette transporter, major histocompatibility complex, 1; ATP dependent transport protein family member; histocompatibility antigen modifier 1 (Ham-1, Ham1); MTP1; peptide supply factor 1 (PSF-1); peptide transporter PSF1; RING4; transporter 1, ABC; transporter 1, ATP-binding cassette, sub-family B; transporter, ABC, MHC, 1; transporter, ATP-binding cassette, major histocompatibility complex, 1; transporter associated with antigen processing 1 (Tap-1, TAP); Y3
MMRRC Submission 040796-MU
Accession Numbers

Genbank: NM_013683; MGI: 98483

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3883 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34187553-34197225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34193258 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 479 (V479E)
Ref Sequence ENSEMBL: ENSMUSP00000128401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025196] [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000173441]
Predicted Effect probably benign
Transcript: ENSMUST00000025196
SMART Domains Protein: ENSMUSP00000025196
Gene: ENSMUSG00000024338

DomainStartEndE-ValueType
Pfam:Proteasome 69 251 1.9e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041633
AA Change: V451E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321
AA Change: V451E

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168351
Predicted Effect probably damaging
Transcript: ENSMUST00000170086
AA Change: V479E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321
AA Change: V479E

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000171148
AA Change: V148E
SMART Domains Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321
AA Change: V148E

DomainStartEndE-ValueType
Pfam:ABC_membrane 1 114 1.5e-24 PFAM
Pfam:ABC_tran 167 196 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173441
SMART Domains Protein: ENSMUSP00000134664
Gene: ENSMUSG00000024338

DomainStartEndE-ValueType
Pfam:Proteasome 69 248 6.3e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
Allele List at MGI
All alleles(2) : Targeted, knock-out(2)
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 C T 8: 46,527,191 S423L probably benign Het
Ankmy1 T G 1: 92,886,152 E435A probably damaging Het
Ano5 T A 7: 51,566,304 M343K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
C3 T C 17: 57,217,173 probably null Het
C530008M17Rik T A 5: 76,856,574 W261R unknown Het
Cdk17 T C 10: 93,212,077 probably null Het
Cntn2 A G 1: 132,528,939 V123A probably damaging Het
Dchs1 A G 7: 105,762,563 Y1449H probably damaging Het
Ddx42 T A 11: 106,247,692 N772K probably benign Het
Dnah11 T C 12: 117,978,453 probably benign Het
Edn1 T A 13: 42,301,906 F4L probably benign Het
Epb41l3 C T 17: 69,274,116 R552* probably null Het
Epc1 T C 18: 6,452,258 D267G possibly damaging Het
Fbxo22 A T 9: 55,223,262 T169S probably benign Het
Fmnl1 A G 11: 103,182,114 N144D probably damaging Het
Folh1 A G 7: 86,775,656 L35P possibly damaging Het
Gm10220 A C 5: 26,116,910 S255A possibly damaging Het
Gm15446 G T 5: 109,940,447 V9L probably damaging Het
Hipk2 A G 6: 38,699,265 L1011P probably damaging Het
Kif4-ps G T 12: 101,146,214 V201L probably damaging Het
Klk1b16 T C 7: 44,139,463 V40A possibly damaging Het
Lgsn C A 1: 31,176,459 D3E probably benign Het
Mavs T C 2: 131,245,298 S239P probably benign Het
Mkl2 T A 16: 13,401,458 V667D probably damaging Het
Mtrf1 A G 14: 79,419,267 Y403C probably damaging Het
Mycbp2 A C 14: 103,295,250 L390V probably damaging Het
Neto2 A G 8: 85,663,265 S190P probably damaging Het
Ngly1 A G 14: 16,270,574 I195V probably damaging Het
Olfr1339 T C 4: 118,734,685 I52T probably benign Het
Olfr961 A G 9: 39,647,124 I133V probably benign Het
Pde4dip T C 3: 97,713,188 K1632E probably damaging Het
Pigk T C 3: 152,714,195 S21P probably benign Het
Rabggtb A G 3: 153,910,780 F82L probably damaging Het
Reep6 G A 10: 80,335,535 R415Q probably benign Het
Serpinb13 T C 1: 106,998,572 V159A probably benign Het
Slc5a8 T A 10: 88,902,463 M196K possibly damaging Het
Sprr1a G A 3: 92,484,520 P58L probably damaging Het
Taf1a A T 1: 183,390,948 T10S possibly damaging Het
Trpm4 C T 7: 45,321,998 probably null Het
Ush2a T C 1: 188,263,382 Y117H probably benign Het
Vmn2r58 A T 7: 41,864,490 L243* probably null Het
Zbtb32 A G 7: 30,591,144 I242T probably benign Het
Zbtb7a T C 10: 81,148,025 C434R probably damaging Het
Other mutations in Tap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
rose APN 17 34194940 missense probably damaging 1.00
IGL01294:Tap1 APN 17 34194045 critical splice donor site probably null
IGL01776:Tap1 APN 17 34193128 missense possibly damaging 0.82
IGL01787:Tap1 APN 17 34196604 missense probably benign 0.21
IGL02246:Tap1 APN 17 34193989 missense probably benign 0.01
IGL02996:Tap1 APN 17 34191396 missense probably damaging 1.00
IGL03278:Tap1 APN 17 34191483 missense probably damaging 1.00
joplin UTSW 17 34193258 missense probably damaging 1.00
ragtime UTSW 17 34190642 nonsense probably null
rose2 UTSW 17 34194941 missense probably damaging 1.00
PIT4802001:Tap1 UTSW 17 34193191 missense probably damaging 1.00
R1566:Tap1 UTSW 17 34189546 missense probably benign 0.00
R1795:Tap1 UTSW 17 34194925 missense probably benign 0.21
R1837:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1839:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1892:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1893:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1952:Tap1 UTSW 17 34193507 missense probably damaging 1.00
R2163:Tap1 UTSW 17 34189473 unclassified probably null
R3744:Tap1 UTSW 17 34193612 missense probably damaging 1.00
R3975:Tap1 UTSW 17 34189567 unclassified probably benign
R4418:Tap1 UTSW 17 34188379 unclassified probably null
R4779:Tap1 UTSW 17 34193891 missense probably damaging 1.00
R4913:Tap1 UTSW 17 34193494 missense possibly damaging 0.94
R5715:Tap1 UTSW 17 34192894 nonsense probably null
R5838:Tap1 UTSW 17 34193305 nonsense probably null
R6248:Tap1 UTSW 17 34193177 missense probably damaging 0.99
R6710:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R6881:Tap1 UTSW 17 34188034 missense probably damaging 0.99
R7437:Tap1 UTSW 17 34190642 nonsense probably null
R7514:Tap1 UTSW 17 34196665 missense probably damaging 1.00
R7618:Tap1 UTSW 17 34188238 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGCAGGTTAGACGGCTCAC -3'
(R):5'- TTCCAGGATGCAGGGTGAAC -3'

Sequencing Primer
(F):5'- AGACGGCTCACTTGCTTTCG -3'
(R):5'- TGCAGGGTGAACGTCAGC -3'
Posted On2015-04-17