Incidental Mutation 'R1795:Tap1'
ID202191
Institutional Source Beutler Lab
Gene Symbol Tap1
Ensembl Gene ENSMUSG00000037321
Gene Nametransporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
SynonymsABC transporter, MHC, 1; ABC17; antigen peptide transporter (APT1); ATP-binding cassette, subfamily B, member 2 (Abcb2); ATP-binding cassette, sub-family B (MDR/TAP), member 2; ATP-binding cassette transporter, major histocompatibility complex, 1; ATP dependent transport protein family member; histocompatibility antigen modifier 1 (Ham-1, Ham1); MTP1; peptide supply factor 1 (PSF-1); peptide transporter PSF1; RING4; transporter 1, ABC; transporter 1, ATP-binding cassette, sub-family B; transporter, ABC, MHC, 1; transporter, ATP-binding cassette, major histocompatibility complex, 1; transporter associated with antigen processing 1 (Tap-1, TAP); Y3
MMRRC Submission 039825-MU
Accession Numbers

Genbank: NM_013683; MGI: 98483

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1795 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34187553-34197225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34194925 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 638 (L638P)
Ref Sequence ENSEMBL: ENSMUSP00000128401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025196] [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000173441]
Predicted Effect probably benign
Transcript: ENSMUST00000025196
SMART Domains Protein: ENSMUSP00000025196
Gene: ENSMUSG00000024338

DomainStartEndE-ValueType
Pfam:Proteasome 69 251 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041633
AA Change: L610P

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321
AA Change: L610P

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168351
Predicted Effect probably benign
Transcript: ENSMUST00000170086
AA Change: L638P

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321
AA Change: L638P

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171148
SMART Domains Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
Pfam:ABC_membrane 1 114 1.5e-24 PFAM
Pfam:ABC_tran 167 196 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172960
Predicted Effect probably benign
Transcript: ENSMUST00000173441
SMART Domains Protein: ENSMUSP00000134664
Gene: ENSMUSG00000024338

DomainStartEndE-ValueType
Pfam:Proteasome 69 248 6.3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173770
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
Allele List at MGI
All alleles(2) : Targeted, knock-out(2)
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,682,989 G1037* probably null Het
Abca8a A G 11: 110,050,966 I1159T probably benign Het
Abcc1 T C 16: 14,465,137 V1159A possibly damaging Het
Abcg5 A G 17: 84,673,579 I194T probably damaging Het
Abtb2 A G 2: 103,567,024 T100A probably benign Het
Adam4 C T 12: 81,421,294 M184I probably benign Het
Afap1l2 T C 19: 56,928,409 D155G probably damaging Het
Ahnak T C 19: 9,002,438 V362A possibly damaging Het
Ak7 C T 12: 105,726,223 R179* probably null Het
Akap8 C A 17: 32,315,477 G332C probably damaging Het
Akr1e1 T A 13: 4,595,072 Q204L probably damaging Het
Ankrd12 T C 17: 65,986,227 E737G possibly damaging Het
Atrn A G 2: 130,972,288 D718G probably benign Het
Bco2 A G 9: 50,541,169 S200P possibly damaging Het
C030005K15Rik A T 10: 97,725,786 S28T unknown Het
Cdc14a T A 3: 116,298,473 Q356L possibly damaging Het
Cdk5rap3 A G 11: 96,908,828 L387P probably damaging Het
Celsr1 A T 15: 86,030,323 S1150T probably damaging Het
Cntfr A G 4: 41,670,841 probably null Het
Cramp1l T C 17: 24,964,910 N1244D probably damaging Het
Csmd3 G T 15: 47,857,920 D1542E possibly damaging Het
Cyp4f17 A T 17: 32,517,969 I92F probably benign Het
Dhx30 A T 9: 110,107,983 probably null Het
Dlg1 T A 16: 31,743,147 H120Q probably benign Het
Dmgdh A T 13: 93,706,699 M348L probably benign Het
Dnmt3b G A 2: 153,683,639 E741K possibly damaging Het
Dock3 T G 9: 107,025,335 H292P probably damaging Het
Elmsan1 A G 12: 84,158,974 probably null Het
Ercc6 T A 14: 32,517,028 N24K probably benign Het
Esco2 T C 14: 65,827,277 Q338R probably benign Het
Etl4 T C 2: 20,808,026 probably null Het
Exoc7 A T 11: 116,292,521 I498N probably damaging Het
Fap G A 2: 62,548,589 S123L probably damaging Het
Foxn1 T C 11: 78,371,225 E106G probably benign Het
Fscb T A 12: 64,474,401 D97V probably damaging Het
Gabrg1 T C 5: 70,782,253 T174A possibly damaging Het
Gan C T 8: 117,196,460 A461V possibly damaging Het
Gbp2 T A 3: 142,630,523 D211E possibly damaging Het
Gm10271 A T 10: 116,956,841 Y47N unknown Het
Gm17333 G T 16: 77,852,823 noncoding transcript Het
Gm1758 T A 16: 14,502,278 noncoding transcript Het
Golga3 A G 5: 110,207,627 K989R possibly damaging Het
Gucy2g C A 19: 55,199,541 V1041F probably damaging Het
Guk1 A T 11: 59,186,813 F25I probably benign Het
H2al1o C T X: 9,572,090 E87K possibly damaging Het
Hemgn C A 4: 46,395,958 C426F probably damaging Het
Hps3 A G 3: 20,012,695 probably null Het
Il2rb A T 15: 78,483,987 D287E probably damaging Het
Ino80 A T 2: 119,406,859 V1123D probably damaging Het
Kdm2b A G 5: 122,984,460 probably null Het
Kif21a A T 15: 90,972,727 probably null Het
Klhl33 A T 14: 50,892,126 N347K probably damaging Het
Krt2 A G 15: 101,816,426 F250L possibly damaging Het
Krt82 T A 15: 101,543,384 N332I possibly damaging Het
Lgi1 A G 19: 38,306,183 I444V probably benign Het
Lmod1 G A 1: 135,325,124 V39M probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mex3d T C 10: 80,381,542 T149A probably benign Het
Mlxipl A C 5: 135,107,170 D83A probably damaging Het
Mroh8 T A 2: 157,269,551 E161V probably benign Het
Mroh9 G A 1: 163,056,778 T397I probably damaging Het
Mtss1 T C 15: 59,058,400 D32G possibly damaging Het
Mus81 T C 19: 5,483,476 D495G probably benign Het
Neurod1 A C 2: 79,454,329 S237A probably benign Het
Npas1 G A 7: 16,474,800 R51C probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
P2ry14 T C 3: 59,115,853 N62S probably damaging Het
Pcdh15 A G 10: 74,624,255 Y1308C probably damaging Het
Pcdhb14 A T 18: 37,449,535 M565L probably benign Het
Pde6a A G 18: 61,257,212 E502G probably damaging Het
Pde8b A G 13: 95,042,019 V566A probably benign Het
Phf11b G T 14: 59,328,105 Q108K probably benign Het
Pikfyve T C 1: 65,252,557 Y1312H probably damaging Het
Plcb3 T C 19: 6,956,013 probably benign Het
Plxna2 G A 1: 194,806,303 G1629D probably damaging Het
Plxnb1 T C 9: 109,100,745 V223A probably benign Het
Prkca A T 11: 108,012,692 Y285N possibly damaging Het
Prl2a1 A T 13: 27,808,571 N226I probably damaging Het
Pus7 A C 5: 23,741,916 M636R probably damaging Het
Samd9l G A 6: 3,375,264 Q666* probably null Het
Sema3d A G 5: 12,584,887 D640G probably benign Het
Slc6a15 A G 10: 103,400,260 I279V probably benign Het
Slk T C 19: 47,620,534 V642A possibly damaging Het
Spta1 T A 1: 174,245,730 M2305K probably damaging Het
Srrt T C 5: 137,303,012 probably benign Het
Stfa2l1 A T 16: 36,156,858 I8L probably benign Het
Tbccd1 A T 16: 22,822,245 L461M probably benign Het
Tecta T C 9: 42,378,049 T407A probably benign Het
Tmbim7 T C 5: 3,657,493 probably null Het
Tnrc18 C A 5: 142,815,114 V30L probably benign Het
Tomm7 A G 5: 23,844,027 F16S probably damaging Het
Ugt2a2 A G 5: 87,474,456 S428P probably benign Het
Vmn1r189 T C 13: 22,102,154 E171G probably benign Het
Vmn1r61 T C 7: 5,611,325 probably benign Het
Vmn2r120 A T 17: 57,525,038 S250R probably benign Het
Vmn2r8 T C 5: 108,803,106 R158G probably benign Het
Vmn2r98 A T 17: 19,066,440 Y400F probably damaging Het
Vps13c C A 9: 67,893,985 Y582* probably null Het
Zfp518a T A 19: 40,915,556 F1310I probably benign Het
Zswim1 A G 2: 164,825,400 I191V probably benign Het
Other mutations in Tap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
rose APN 17 34194940 missense probably damaging 1.00
IGL01294:Tap1 APN 17 34194045 critical splice donor site probably null
IGL01776:Tap1 APN 17 34193128 missense possibly damaging 0.82
IGL01787:Tap1 APN 17 34196604 missense probably benign 0.21
IGL02246:Tap1 APN 17 34193989 missense probably benign 0.01
IGL02996:Tap1 APN 17 34191396 missense probably damaging 1.00
IGL03278:Tap1 APN 17 34191483 missense probably damaging 1.00
joplin UTSW 17 34193258 missense probably damaging 1.00
ragtime UTSW 17 34190642 nonsense probably null
rose2 UTSW 17 34194941 missense probably damaging 1.00
PIT4802001:Tap1 UTSW 17 34193191 missense probably damaging 1.00
R1566:Tap1 UTSW 17 34189546 missense probably benign 0.00
R1837:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1839:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1892:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1893:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1952:Tap1 UTSW 17 34193507 missense probably damaging 1.00
R2163:Tap1 UTSW 17 34189473 unclassified probably null
R3744:Tap1 UTSW 17 34193612 missense probably damaging 1.00
R3883:Tap1 UTSW 17 34193258 missense probably damaging 1.00
R3975:Tap1 UTSW 17 34189567 unclassified probably benign
R4418:Tap1 UTSW 17 34188379 unclassified probably null
R4779:Tap1 UTSW 17 34193891 missense probably damaging 1.00
R4913:Tap1 UTSW 17 34193494 missense possibly damaging 0.94
R5715:Tap1 UTSW 17 34192894 nonsense probably null
R5838:Tap1 UTSW 17 34193305 nonsense probably null
R6248:Tap1 UTSW 17 34193177 missense probably damaging 0.99
R6710:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R6881:Tap1 UTSW 17 34188034 missense probably damaging 0.99
R7437:Tap1 UTSW 17 34190642 nonsense probably null
R7514:Tap1 UTSW 17 34196665 missense probably damaging 1.00
R7618:Tap1 UTSW 17 34188238 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGTATGTGTGCCTATGTGAATG -3'
(R):5'- CTTCAGGGAGATGACACAGC -3'

Sequencing Primer
(F):5'- ATATGCCTATGTGAGTACGTATGTG -3'
(R):5'- CCTCCAGAGGTAGCAGCAG -3'
Posted On2014-06-23