Incidental Mutation 'R3910:Olfr700'
ID309341
Institutional Source Beutler Lab
Gene Symbol Olfr700
Ensembl Gene ENSMUSG00000094493
Gene Nameolfactory receptor 700
SynonymsGA_x6K02T2PBJ9-9184187-9183237, MOR283-4
MMRRC Submission 040815-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3910 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106805395-106808834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106805865 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 199 (V199D)
Ref Sequence ENSEMBL: ENSMUSP00000150320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079936] [ENSMUST00000214840]
Predicted Effect probably damaging
Transcript: ENSMUST00000079936
AA Change: V199D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078855
Gene: ENSMUSG00000094493
AA Change: V199D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.6e-5 PFAM
Pfam:7tm_1 41 290 3.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209339
Predicted Effect probably damaging
Transcript: ENSMUST00000214840
AA Change: V199D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
4931409K22Rik A T 5: 24,545,442 probably benign Het
9030624J02Rik A G 7: 118,746,390 T49A possibly damaging Het
Bod1l T C 5: 41,817,098 E2291G probably damaging Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Fap A G 2: 62,556,104 S58P probably damaging Het
Flnc A T 6: 29,459,427 T2509S probably damaging Het
Fnip2 A T 3: 79,479,505 D971E possibly damaging Het
Gab2 A G 7: 97,299,073 Y290C probably damaging Het
Gm7104 C T 12: 88,284,594 noncoding transcript Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Lgr5 A G 10: 115,587,463 S11P possibly damaging Het
Mycn T A 12: 12,937,280 N372I probably damaging Het
Olfr459 A G 6: 41,772,149 V50A probably benign Het
Paxbp1 T A 16: 91,042,681 E117V probably damaging Het
Phc2 T C 4: 128,743,558 probably null Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Robo3 A T 9: 37,419,295 Y1002N probably damaging Het
Svep1 A T 4: 58,145,156 probably null Het
Thsd7a A G 6: 12,331,549 V1342A probably damaging Het
Tmtc3 A C 10: 100,449,026 N582K probably damaging Het
Tnfrsf11b G A 15: 54,256,182 probably benign Het
Trim30a A G 7: 104,411,141 V476A probably damaging Het
Ugt1a8 A G 1: 88,088,048 E61G possibly damaging Het
Vmn1r75 A T 7: 11,880,830 N163I possibly damaging Het
Zfp119a G A 17: 55,866,520 L108F probably benign Het
Other mutations in Olfr700
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Olfr700 APN 7 106806435 missense probably benign 0.03
IGL01474:Olfr700 APN 7 106805940 missense probably benign 0.23
IGL01720:Olfr700 APN 7 106806209 missense probably damaging 0.99
R0501:Olfr700 UTSW 7 106805811 missense probably damaging 1.00
R2061:Olfr700 UTSW 7 106805768 missense probably benign 0.00
R2511:Olfr700 UTSW 7 106805961 missense probably damaging 1.00
R2876:Olfr700 UTSW 7 106805997 missense probably benign 0.00
R3816:Olfr700 UTSW 7 106805820 missense probably damaging 1.00
R3911:Olfr700 UTSW 7 106805865 missense probably damaging 1.00
R3912:Olfr700 UTSW 7 106805865 missense probably damaging 1.00
R4855:Olfr700 UTSW 7 106806256 missense probably benign 0.01
R4864:Olfr700 UTSW 7 106805964 missense probably damaging 1.00
R5101:Olfr700 UTSW 7 106806213 missense possibly damaging 0.53
R5335:Olfr700 UTSW 7 106805734 missense probably damaging 1.00
R6217:Olfr700 UTSW 7 106806072 missense probably damaging 1.00
R6880:Olfr700 UTSW 7 106805812 missense probably damaging 1.00
R7522:Olfr700 UTSW 7 106805787 missense probably damaging 0.99
R8260:Olfr700 UTSW 7 106806027 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGAGCTGGGGTGACAATTG -3'
(R):5'- AACCTAGGATCTGCTGGCTTG -3'

Sequencing Primer
(F):5'- CTGGGGTGACAATTGTGTAGAAAAC -3'
(R):5'- GGAGTGTTCATATCATGGACCC -3'
Posted On2015-04-17