Incidental Mutation 'R3894:Gm10277'
ID310460
Institutional Source Beutler Lab
Gene Symbol Gm10277
Ensembl Gene ENSMUSG00000069804
Gene Namepredicted gene 10277
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3894 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location77785453-77787747 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 77786001 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000092883] [ENSMUST00000092887] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000130627] [ENSMUST00000168348] [ENSMUST00000169105]
Predicted Effect probably benign
Transcript: ENSMUST00000000645
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000092883
AA Change: N48S
SMART Domains Protein: ENSMUSP00000090559
Gene: ENSMUSG00000069804
AA Change: N48S

DomainStartEndE-ValueType
low complexity region 84 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092887
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102488
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108375
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108376
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130627
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168348
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169105
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1s1 A G 7: 44,853,939 D180G probably damaging Het
Aldh1a7 A T 19: 20,696,398 Y457* probably null Het
Alpk3 C T 7: 81,078,390 P423S possibly damaging Het
Aox2 A T 1: 58,334,678 probably null Het
Crebbp T C 16: 4,096,102 T1316A probably benign Het
Cul3 C A 1: 80,283,690 V273F probably damaging Het
Dnah1 G T 14: 31,307,028 R582S probably benign Het
Fbxl2 T C 9: 114,003,193 N51S probably damaging Het
Gapvd1 T C 2: 34,728,476 D295G probably benign Het
Gdf7 A G 12: 8,298,845 S151P unknown Het
Hdac4 T C 1: 91,970,968 E688G possibly damaging Het
Htr1d A G 4: 136,443,237 E259G probably benign Het
Ifi204 T C 1: 173,749,208 H609R possibly damaging Het
Ift80 T C 3: 68,917,999 D541G probably damaging Het
Il18r1 A T 1: 40,474,874 H80L possibly damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mesd T A 7: 83,897,785 L152H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mut G A 17: 40,955,139 C531Y probably damaging Het
Myo15 A G 11: 60,504,319 T2480A probably benign Het
Olfr1284 C A 2: 111,379,637 F212L probably benign Het
Olfr1317 T C 2: 112,142,014 I23T probably benign Het
Olfr1387 G A 11: 49,459,939 G87R possibly damaging Het
Olfr180 A G 16: 58,916,339 F101L probably benign Het
Olfr437 A T 6: 43,167,258 I67F probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcbp4 A T 9: 106,461,371 Q59L possibly damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Rad50 T A 11: 53,678,870 I905L probably benign Het
Rp1l1 T C 14: 64,029,307 S781P probably benign Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rtn3 T A 19: 7,435,085 T86S probably damaging Het
Sdha A T 13: 74,334,391 S268T probably benign Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Sh3glb2 T C 2: 30,355,288 T60A probably damaging Het
Slc26a3 A C 12: 31,464,720 Y513S probably damaging Het
Slc35b2 T C 17: 45,566,442 V165A probably benign Het
Slco3a1 A G 7: 74,284,613 W604R probably damaging Het
Tet2 A G 3: 133,469,477 S1370P possibly damaging Het
Tmtc4 A T 14: 122,921,319 probably null Het
Tsga13 A G 6: 30,912,263 V18A probably benign Het
Ugt2a3 T C 5: 87,329,590 T317A probably benign Het
Zcchc4 A T 5: 52,784,100 D79V probably damaging Het
Other mutations in Gm10277
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1724:Gm10277 UTSW 11 77786002 frame shift probably null
R1725:Gm10277 UTSW 11 77786002 frame shift probably null
R1726:Gm10277 UTSW 11 77786002 frame shift probably null
R1741:Gm10277 UTSW 11 77786002 frame shift probably null
R1742:Gm10277 UTSW 11 77786002 frame shift probably null
R1909:Gm10277 UTSW 11 77786002 frame shift probably null
R2023:Gm10277 UTSW 11 77786002 frame shift probably null
R2115:Gm10277 UTSW 11 77786002 frame shift probably null
R2116:Gm10277 UTSW 11 77786002 frame shift probably null
R3008:Gm10277 UTSW 11 77785536 intron probably benign
R4732:Gm10277 UTSW 11 77786097 intron probably benign
R4733:Gm10277 UTSW 11 77786097 intron probably benign
R4771:Gm10277 UTSW 11 77785708 intron probably benign
R7366:Gm10277 UTSW 11 77785758 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTTTCAGCCCTGACAAGCC -3'
(R):5'- AGTCAGCTCCTTACAGAAATGGG -3'

Sequencing Primer
(F):5'- TGACAAGCCGATCTGGAGATCTC -3'
(R):5'- TCAGCTCCTTACAGAAATGGGAATGG -3'
Posted On2015-04-17