Mutagenetix > Incidental Mutations

Incidental Mutation 'R3894:Rp1l1'

310467

Institutional Source

Beutler Lab

Gene Symbol

Rp1l1

Ensembl Gene

ENSMUSG00000046049

Gene Name

retinitis pigmentosa 1 homolog like 1

Synonyms

Dcdc4, Rp1hl1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R3894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63992506-64035025 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64029307 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 781 (S781P)

Ref Sequence

ENSEMBL: ENSMUSP00000055449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058229]

Predicted Effect

probably benign
Transcript: ENSMUST00000058229
AA Change: S781P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: S781P

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
DCX	37	121	1.58e-13	SMART
DCX	155	239	1e-15	SMART
low complexity region	709	728	N/A	INTRINSIC
low complexity region	870	884	N/A	INTRINSIC
low complexity region	1159	1177	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1612	1618	N/A	INTRINSIC
low complexity region	1642	1652	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224314

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akt1s1	A	G	7: 44,853,939	D180G	probably damaging	Het
Aldh1a7	A	T	19: 20,696,398	Y457*	probably null	Het
Alpk3	C	T	7: 81,078,390	P423S	possibly damaging	Het
Aox2	A	T	1: 58,334,678		probably null	Het
Crebbp	T	C	16: 4,096,102	T1316A	probably benign	Het
Cul3	C	A	1: 80,283,690	V273F	probably damaging	Het
Dnah1	G	T	14: 31,307,028	R582S	probably benign	Het
Fbxl2	T	C	9: 114,003,193	N51S	probably damaging	Het
Gapvd1	T	C	2: 34,728,476	D295G	probably benign	Het
Gdf7	A	G	12: 8,298,845	S151P	unknown	Het
Gm10277	T	C	11: 77,786,001		probably benign	Het
Hdac4	T	C	1: 91,970,968	E688G	possibly damaging	Het
Htr1d	A	G	4: 136,443,237	E259G	probably benign	Het
Ifi204	T	C	1: 173,749,208	H609R	possibly damaging	Het
Ift80	T	C	3: 68,917,999	D541G	probably damaging	Het
Il18r1	A	T	1: 40,474,874	H80L	possibly damaging	Het
Lrp4	G	A	2: 91,473,949	G158S	probably damaging	Het
Mesd	T	A	7: 83,897,785	L152H	probably damaging	Het
Morf4l1	A	T	9: 90,094,448	F276I	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mut	G	A	17: 40,955,139	C531Y	probably damaging	Het
Myo15	A	G	11: 60,504,319	T2480A	probably benign	Het
Olfr1284	C	A	2: 111,379,637	F212L	probably benign	Het
Olfr1317	T	C	2: 112,142,014	I23T	probably benign	Het
Olfr1387	G	A	11: 49,459,939	G87R	possibly damaging	Het
Olfr180	A	G	16: 58,916,339	F101L	probably benign	Het
Olfr437	A	T	6: 43,167,258	I67F	probably benign	Het
Ovgp1	T	C	3: 105,986,567		probably benign	Het
Ovgp1	A	G	3: 105,986,596		probably benign	Het
Pcbp4	A	T	9: 106,461,371	Q59L	possibly damaging	Het
Prg4	G	C	1: 150,454,759		probably benign	Het
Rad50	T	A	11: 53,678,870	I905L	probably benign	Het
Rps3	C	T	7: 99,479,896	R173H	probably benign	Het
Rtn3	T	A	19: 7,435,085	T86S	probably damaging	Het
Sdha	A	T	13: 74,334,391	S268T	probably benign	Het
Sgo2b	A	T	8: 63,928,733	V355E	possibly damaging	Het
Sh3glb2	T	C	2: 30,355,288	T60A	probably damaging	Het
Slc26a3	A	C	12: 31,464,720	Y513S	probably damaging	Het
Slc35b2	T	C	17: 45,566,442	V165A	probably benign	Het
Slco3a1	A	G	7: 74,284,613	W604R	probably damaging	Het
Tet2	A	G	3: 133,469,477	S1370P	possibly damaging	Het
Tmtc4	A	T	14: 122,921,319		probably null	Het
Tsga13	A	G	6: 30,912,263	V18A	probably benign	Het
Ugt2a3	T	C	5: 87,329,590	T317A	probably benign	Het
Zcchc4	A	T	5: 52,784,100	D79V	probably damaging	Het

Other mutations in Rp1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Rp1l1	APN	14	64028725	missense	probably benign	0.01
IGL02063:Rp1l1	APN	14	64029536	missense	probably damaging	0.99
IGL02132:Rp1l1	APN	14	64028810	missense	probably benign
IGL02430:Rp1l1	APN	14	64029286	missense	probably benign	0.00
IGL02977:Rp1l1	APN	14	64028150	missense	probably benign	0.01
IGL03213:Rp1l1	APN	14	64028415	missense	probably damaging	0.98
IGL03346:Rp1l1	APN	14	64029440	missense	probably benign
R0085:Rp1l1	UTSW	14	64022295	missense	probably damaging	0.99
R0347:Rp1l1	UTSW	14	64030804	nonsense	probably null
R0362:Rp1l1	UTSW	14	64031066	nonsense	probably null
R0369:Rp1l1	UTSW	14	64029388	missense	possibly damaging	0.84
R0538:Rp1l1	UTSW	14	64022092	missense	probably damaging	1.00
R0544:Rp1l1	UTSW	14	64032066	missense	probably benign	0.00
R0780:Rp1l1	UTSW	14	64030351	missense	possibly damaging	0.94
R0944:Rp1l1	UTSW	14	64032232	missense	probably benign	0.05
R1051:Rp1l1	UTSW	14	64032535	missense	probably damaging	0.99
R1126:Rp1l1	UTSW	14	64030469	missense	probably damaging	1.00
R1450:Rp1l1	UTSW	14	64028150	missense	probably benign	0.01
R1483:Rp1l1	UTSW	14	64029047	missense	possibly damaging	0.76
R1508:Rp1l1	UTSW	14	64030892	missense	possibly damaging	0.83
R1553:Rp1l1	UTSW	14	64031894	missense	probably benign	0.00
R1651:Rp1l1	UTSW	14	64030993	missense	probably damaging	0.97
R1682:Rp1l1	UTSW	14	64028968	missense	probably damaging	0.98
R1809:Rp1l1	UTSW	14	64027966	missense	probably benign	0.18
R1885:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1887:Rp1l1	UTSW	14	64028390	missense	probably benign	0.01
R1898:Rp1l1	UTSW	14	64031590	missense	probably benign	0.04
R1924:Rp1l1	UTSW	14	64031543	missense	probably benign
R1939:Rp1l1	UTSW	14	64029593	missense	probably benign
R1941:Rp1l1	UTSW	14	64022252	missense	probably damaging	1.00
R2129:Rp1l1	UTSW	14	64028966	missense	possibly damaging	0.93
R2363:Rp1l1	UTSW	14	64029998	missense	possibly damaging	0.55
R3974:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3975:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R3976:Rp1l1	UTSW	14	64030309	missense	probably damaging	1.00
R4072:Rp1l1	UTSW	14	64028132	missense	probably damaging	1.00
R4672:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4673:Rp1l1	UTSW	14	64031270	missense	probably damaging	1.00
R4749:Rp1l1	UTSW	14	64029800	missense	probably damaging	0.99
R4755:Rp1l1	UTSW	14	64030070	missense	probably benign	0.34
R4877:Rp1l1	UTSW	14	64026171	missense	probably benign	0.00
R4930:Rp1l1	UTSW	14	64032206	missense	probably benign
R5039:Rp1l1	UTSW	14	64031356	missense	probably benign	0.21
R5106:Rp1l1	UTSW	14	64027946	missense	probably damaging	1.00
R5184:Rp1l1	UTSW	14	64030180	missense	probably damaging	1.00
R5215:Rp1l1	UTSW	14	64030013	missense	probably benign	0.01
R5409:Rp1l1	UTSW	14	64030621	missense	probably benign	0.02
R5575:Rp1l1	UTSW	14	64030984	missense	probably benign	0.23
R5696:Rp1l1	UTSW	14	64029746	missense	probably damaging	0.99
R5739:Rp1l1	UTSW	14	64032170	missense	probably benign	0.01
R5878:Rp1l1	UTSW	14	64028906	missense	probably benign	0.09
R6133:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6134:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6135:Rp1l1	UTSW	14	64030096	missense	probably damaging	1.00
R6428:Rp1l1	UTSW	14	64032389	missense	possibly damaging	0.92
R6594:Rp1l1	UTSW	14	64031677	nonsense	probably null
R6736:Rp1l1	UTSW	14	64029724	missense	possibly damaging	0.93
R6800:Rp1l1	UTSW	14	64031150	missense	possibly damaging	0.92
R6848:Rp1l1	UTSW	14	64028218	missense	possibly damaging	0.79
R6878:Rp1l1	UTSW	14	64031852	missense	probably benign	0.00
R6922:Rp1l1	UTSW	14	64030385	missense	possibly damaging	0.93
R6980:Rp1l1	UTSW	14	64028720	missense	probably benign	0.02
R7053:Rp1l1	UTSW	14	64031509	missense	possibly damaging	0.68
R7151:Rp1l1	UTSW	14	64029026	missense	possibly damaging	0.73
R7291:Rp1l1	UTSW	14	64032298	missense	probably benign	0.10
R7335:Rp1l1	UTSW	14	64031998	missense	probably benign	0.00
R7344:Rp1l1	UTSW	14	64029620	missense	probably benign	0.00
R7470:Rp1l1	UTSW	14	64028566	missense	probably benign
R7570:Rp1l1	UTSW	14	64031574	nonsense	probably null
R7585:Rp1l1	UTSW	14	64030139	missense	probably damaging	0.96
R7591:Rp1l1	UTSW	14	64026109	missense	probably damaging	1.00
R7667:Rp1l1	UTSW	14	64029803	missense	probably benign	0.04
R7862:Rp1l1	UTSW	14	64028027	missense	probably damaging	1.00
R7935:Rp1l1	UTSW	14	64031225	missense	probably damaging	0.99
R8256:Rp1l1	UTSW	14	64028153	missense	probably benign	0.18
R8403:Rp1l1	UTSW	14	64028809	missense	probably benign	0.21
X0057:Rp1l1	UTSW	14	64030040	missense	probably benign	0.14
X0063:Rp1l1	UTSW	14	64029223	missense	probably damaging	0.98
Z1088:Rp1l1	UTSW	14	64028758	missense	possibly damaging	0.80
Z1088:Rp1l1	UTSW	14	64030378	missense	probably benign	0.01
Z1176:Rp1l1	UTSW	14	64029144	missense	probably damaging	1.00
Z1177:Rp1l1	UTSW	14	64032297	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGAATCAAGCCTCTGAGGAC -3'
(R):5'- TGGAGTTGGGCAGAAACTAC -3'

Sequencing Primer
(F):5'- AAGCCTCTGAGGACCTGAGATC -3'
(R):5'- CCTAAGCAGGCCTCAGAGATG -3'

Posted On

2015-04-17