Incidental Mutation 'R4006:Trim23'
ID311488
Institutional Source Beutler Lab
Gene Symbol Trim23
Ensembl Gene ENSMUSG00000021712
Gene Nametripartite motif-containing 23
Synonyms6330516O20Rik, Arfd1
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location104178797-104203372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104187623 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 177 (T177A)
Ref Sequence ENSEMBL: ENSMUSP00000069371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022225] [ENSMUST00000069174] [ENSMUST00000069187]
Predicted Effect probably benign
Transcript: ENSMUST00000022225
AA Change: T197A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022225
Gene: ENSMUSG00000021712
AA Change: T197A

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 1.32e-4 SMART
BBC 226 370 2.89e-41 SMART
ARF 387 569 1.15e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069174
AA Change: T177A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069371
Gene: ENSMUSG00000021712
AA Change: T177A

DomainStartEndE-ValueType
RING 11 55 3.07e-5 SMART
BBOX 102 148 3.07e-1 SMART
BBOX 153 199 1.32e-4 SMART
BBC 206 350 2.89e-41 SMART
ARF 367 549 1.15e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069187
AA Change: T197A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070767
Gene: ENSMUSG00000021712
AA Change: T197A

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 5.95e-3 SMART
BBC 182 309 8.07e-22 SMART
ARF 326 508 1.15e-78 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein is also a member of the ADP ribosylation factor family of guanine nucleotide-binding family of proteins. Its carboxy terminus contains an ADP-ribosylation factor domain and a guanine nucleotide binding site, while the amino terminus contains a GTPase activating protein domain which acts on the guanine nucleotide binding site. The protein localizes to lysosomes and the Golgi apparatus. It plays a role in the formation of intracellular transport vesicles, their movement from one compartment to another, and phopholipase D activation. Three alternatively spliced transcript variants for this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Trim23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Trim23 APN 13 104187612 missense probably benign 0.30
R0462:Trim23 UTSW 13 104198033 missense probably damaging 1.00
R0638:Trim23 UTSW 13 104201309 missense probably benign 0.00
R0980:Trim23 UTSW 13 104188127 missense probably damaging 1.00
R1087:Trim23 UTSW 13 104188110 missense possibly damaging 0.66
R1764:Trim23 UTSW 13 104198618 missense probably damaging 1.00
R2441:Trim23 UTSW 13 104192075 missense probably damaging 1.00
R4010:Trim23 UTSW 13 104181018 unclassified probably benign
R5162:Trim23 UTSW 13 104181174 missense probably damaging 0.98
R5383:Trim23 UTSW 13 104198697 missense probably damaging 1.00
R5389:Trim23 UTSW 13 104192033 missense probably damaging 0.96
R5520:Trim23 UTSW 13 104187527 missense probably damaging 1.00
R5539:Trim23 UTSW 13 104198033 missense probably damaging 1.00
R5557:Trim23 UTSW 13 104187509 missense probably damaging 1.00
R7079:Trim23 UTSW 13 104187293 intron probably null
R7249:Trim23 UTSW 13 104188155 missense probably damaging 0.99
R7290:Trim23 UTSW 13 104187433 missense probably damaging 1.00
R7608:Trim23 UTSW 13 104192033 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATGAAGCTCACGTTGCATCTG -3'
(R):5'- TTCCATGCTACTGAGACCAACTC -3'

Sequencing Primer
(F):5'- GAAGCTCACGTTGCATCTGTATATTG -3'
(R):5'- GACCAACTCATTAATCACTTAAC -3'
Posted On2015-04-29