Incidental Mutation 'R4006:Lrrn2'
ID311454
Institutional Source Beutler Lab
Gene Symbol Lrrn2
Ensembl Gene ENSMUSG00000026443
Gene Nameleucine rich repeat protein 2, neuronal
SynonymsNLRR-2, 5730406J09Rik
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132880273-132940005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132937740 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 181 (D181V)
Ref Sequence ENSEMBL: ENSMUSP00000027706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027706]
Predicted Effect probably damaging
Transcript: ENSMUST00000027706
AA Change: D181V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027706
Gene: ENSMUSG00000026443
AA Change: D181V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 28 73 2.22e-2 SMART
LRR 92 115 3.86e0 SMART
LRR 116 139 1.08e-1 SMART
LRR_TYP 140 163 3.21e-4 SMART
LRR 164 187 1.33e-1 SMART
LRR 188 211 5.89e1 SMART
LRR 212 235 1.66e1 SMART
LRR 236 259 4.98e-1 SMART
LRR 260 283 5.26e0 SMART
LRR 309 333 5.56e0 SMART
LRR 334 357 2.17e-1 SMART
LRRCT 369 421 3.13e-3 SMART
IGc2 436 504 9.99e-13 SMART
FN3 525 607 3.49e0 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159088
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leucine-rich repeat superfamily. This gene was found to be amplified and overexpressed in malignant gliomas. The encoded protein has homology with other proteins that function as cell-adhesion molecules or as signal transduction receptors and is a candidate for the target gene in the 1q32.1 amplicon in malignant gliomas. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibited numerous neurological abnormalities when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Dsg4 G A 18: 20,470,965 E830K probably damaging Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Lrrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Lrrn2 APN 1 132938358 missense possibly damaging 0.89
IGL01407:Lrrn2 APN 1 132937227 missense probably damaging 1.00
IGL01636:Lrrn2 APN 1 132937221 missense possibly damaging 0.95
IGL02134:Lrrn2 APN 1 132937817 missense possibly damaging 0.69
IGL02142:Lrrn2 APN 1 132939245 missense possibly damaging 0.86
IGL03240:Lrrn2 APN 1 132938327 missense possibly damaging 0.53
R0226:Lrrn2 UTSW 1 132937820 missense probably damaging 1.00
R0612:Lrrn2 UTSW 1 132937728 missense probably damaging 1.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1969:Lrrn2 UTSW 1 132939234 missense probably benign 0.00
R2087:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
R3923:Lrrn2 UTSW 1 132938492 missense probably benign 0.45
R4022:Lrrn2 UTSW 1 132939114 missense probably benign
R4091:Lrrn2 UTSW 1 132937652 nonsense probably null
R4092:Lrrn2 UTSW 1 132937652 nonsense probably null
R4719:Lrrn2 UTSW 1 132939177 missense probably benign
R5285:Lrrn2 UTSW 1 132939245 missense possibly damaging 0.86
R5681:Lrrn2 UTSW 1 132937161 start gained probably benign
R5791:Lrrn2 UTSW 1 132937767 missense probably benign 0.00
R5916:Lrrn2 UTSW 1 132937800 missense probably damaging 1.00
R6646:Lrrn2 UTSW 1 132939056 missense probably benign
R7021:Lrrn2 UTSW 1 132938784 missense probably damaging 1.00
R7686:Lrrn2 UTSW 1 132938594 missense probably benign 0.04
R7811:Lrrn2 UTSW 1 132939201 missense probably benign
R7869:Lrrn2 UTSW 1 132939378 missense unknown
R7952:Lrrn2 UTSW 1 132939378 missense unknown
R8004:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
Z1177:Lrrn2 UTSW 1 132937898 nonsense probably null
Z1177:Lrrn2 UTSW 1 132938978 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGACTGCGATTTCCAAGCC -3'
(R):5'- AGAGACTCTCCAGGCTTTGC -3'

Sequencing Primer
(F):5'- GCTGCTGAGCCTACATCTAGAAG -3'
(R):5'- GCTTTGCAGTCCCTCCAGAG -3'
Posted On2015-04-29