Incidental Mutation 'R4006:Dsg4'
ID311496
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission 040845-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #R4006 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20470965 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 830 (E830K)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: E830K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: E830K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,526,087 probably null Het
Adamts14 A G 10: 61,202,821 probably null Het
AI481877 A T 4: 59,076,500 V481D possibly damaging Het
Ano4 C A 10: 89,088,263 V329L probably benign Het
Camkv C T 9: 107,946,641 R196W probably damaging Het
Chd9 T C 8: 90,933,560 S383P probably benign Het
Cul4a A G 8: 13,122,859 N164S probably benign Het
Fbln2 C A 6: 91,269,961 probably null Het
Grm8 T C 6: 27,981,230 Y227C probably damaging Het
Gsn G A 2: 35,307,621 W717* probably null Het
Htr2a A T 14: 74,642,141 H70L probably benign Het
Igfn1 C T 1: 135,982,362 probably null Het
Iqsec3 A G 6: 121,376,228 S1144P probably damaging Het
Lpin2 C T 17: 71,246,501 T878I probably damaging Het
Lrrn2 A T 1: 132,937,740 D181V probably damaging Het
Mc1r T C 8: 123,407,637 F43S probably damaging Het
Mst1 A G 9: 108,082,948 E377G possibly damaging Het
Nfatc3 T A 8: 106,108,839 I931N probably benign Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Olfr1082 T C 2: 86,594,564 D88G probably benign Het
Olfr513 C T 7: 108,755,261 T135I probably damaging Het
Pate3 T A 9: 35,646,102 H86L probably damaging Het
Pla2r1 A T 2: 60,522,873 F248Y probably damaging Het
Ppp1r37 A G 7: 19,535,069 S169P probably damaging Het
Prame A T X: 135,613,625 L305Q probably damaging Het
Prkcg G A 7: 3,327,467 V492I probably damaging Het
Psmb11 T A 14: 54,625,646 V107E probably damaging Het
Reg1 A G 6: 78,427,030 D60G probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Trim23 A G 13: 104,187,623 T177A probably benign Het
Xkr4 A T 1: 3,421,775 F308L probably benign Het
Xylt1 A G 7: 117,475,513 I122V probably benign Het
Zan T C 5: 137,463,939 T993A unknown Het
Zbtb20 T C 16: 43,609,399 L18P probably damaging Het
Zfp292 T C 4: 34,807,744 I1767V probably benign Het
Zfp292 G T 4: 34,809,611 S1144R possibly damaging Het
Zfp317 T G 9: 19,648,037 W516G possibly damaging Het
Zfp974 G A 7: 27,912,252 T16I possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGAAGTCACTGAAGCAC -3'
(R):5'- TCAGCCTCTGAGAGAGTCATTCC -3'

Sequencing Primer
(F):5'- GAAGCACAGTTATTACTTCTCTCTGG -3'
(R):5'- CCTCTGAGAGAGTCATTCCTGAAG -3'
Posted On2015-04-29