Incidental Mutation 'R6358:Crhr2'
ID513335
Institutional Source Beutler Lab
Gene Symbol Crhr2
Ensembl Gene ENSMUSG00000003476
Gene Namecorticotropin releasing hormone receptor 2
SynonymsCRF-R2, CRH-R2, Crfr2, CRF 2 receptor, CRFR2beta, CRFR2alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6358 (G1)
Quality Score173.009
Status Validated
Chromosome6
Chromosomal Location55090049-55133016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55093043 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 341 (I341T)
Ref Sequence ENSEMBL: ENSMUSP00000126673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003568] [ENSMUST00000095898] [ENSMUST00000114374] [ENSMUST00000164012] [ENSMUST00000212633] [ENSMUST00000213026]
Predicted Effect probably benign
Transcript: ENSMUST00000003568
AA Change: I340T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000003568
Gene: ENSMUSG00000003476
AA Change: I340T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 8.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095898
SMART Domains Protein: ENSMUSP00000093586
Gene: ENSMUSG00000003476

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 1.75e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114374
AA Change: I320T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000110015
Gene: ENSMUSG00000003476
AA Change: I320T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 3.55e-28 SMART
Pfam:7tm_2 112 354 9.7e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164012
AA Change: I341T

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126673
Gene: ENSMUSG00000003476
AA Change: I341T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204117
Predicted Effect probably benign
Transcript: ENSMUST00000212633
AA Change: I341T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000213026
AA Change: I321T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.3965 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor 2 family, and the subfamily of corticotropin releasing hormone receptor. This receptor shows high affinity for corticotropin releasing hormone (CRH), and also binds CRH-related peptides such as urocortin. CRH is synthesized in the hypothalamus, and plays an important role in coordinating the endocrine, autonomic, and behavioral responses to stress and immune challenge. Studies in mice suggest that this receptor maybe involved in mediating cardiovascular homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous inactivation of this gene may result in hypersensitivity to stress, increased anxiety-like behavior, abnormal homeostatic responses to challenges of increased dietary fat and cold, and cardiovascular abnormalities, including hypertension and decreased cardiac contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Crhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Crhr2 APN 6 55103180 missense probably damaging 1.00
R0278:Crhr2 UTSW 6 55117531 missense probably benign 0.16
R1056:Crhr2 UTSW 6 55100735 missense probably damaging 1.00
R1701:Crhr2 UTSW 6 55099270 missense probably damaging 1.00
R1702:Crhr2 UTSW 6 55092535 missense probably damaging 1.00
R2697:Crhr2 UTSW 6 55102830 missense probably damaging 1.00
R4020:Crhr2 UTSW 6 55100780 splice site probably benign
R4030:Crhr2 UTSW 6 55117677 missense probably benign 0.34
R4527:Crhr2 UTSW 6 55132853 utr 5 prime probably benign
R4698:Crhr2 UTSW 6 55102867 missense possibly damaging 0.90
R4737:Crhr2 UTSW 6 55091305 missense probably damaging 1.00
R5437:Crhr2 UTSW 6 55100733 missense probably damaging 1.00
R5718:Crhr2 UTSW 6 55092100 nonsense probably null
R5719:Crhr2 UTSW 6 55103222 missense probably damaging 1.00
R5945:Crhr2 UTSW 6 55100682 missense possibly damaging 0.93
R6046:Crhr2 UTSW 6 55091292 missense probably damaging 1.00
R6826:Crhr2 UTSW 6 55117740 intron probably benign
R7011:Crhr2 UTSW 6 55099210 critical splice donor site probably null
R7131:Crhr2 UTSW 6 55092127 missense
R7820:Crhr2 UTSW 6 55102779 missense probably damaging 0.97
Z1088:Crhr2 UTSW 6 55103216 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TATAACCCATCCTAGCGTGCCG -3'
(R):5'- AAATGCCTGGACACCTTGACC -3'

Sequencing Primer
(F):5'- GGCTCAGTGTTAGCATCCG -3'
(R):5'- CAAGGGGGTCCAATCACCAG -3'
Posted On2018-04-27