Incidental Mutation 'R3888:Suv39h2'
ID312846
Institutional Source Beutler Lab
Gene Symbol Suv39h2
Ensembl Gene ENSMUSG00000026646
Gene Namesuppressor of variegation 3-9 2
SynonymsSuv39h histone methyltransferase, 4930507K23Rik, D2Ertd544e, KMT1B
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location3455815-3475031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3464808 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 170 (T170I)
Ref Sequence ENSEMBL: ENSMUSP00000027956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027956] [ENSMUST00000060618] [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000115066] [ENSMUST00000127540]
Predicted Effect probably benign
Transcript: ENSMUST00000027956
AA Change: T170I

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027956
Gene: ENSMUSG00000026646
AA Change: T170I

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
CHROMO 117 169 2.44e-11 SMART
Pfam:Pre-SET 212 309 4.4e-18 PFAM
SET 317 446 4.05e-41 SMART
PostSET 461 477 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060618
SMART Domains Protein: ENSMUSP00000054169
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
SET 70 226 6.61e-23 SMART
PostSET 241 257 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061852
SMART Domains Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 1.6e-22 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000100458
AA Change: T67I
SMART Domains Protein: ENSMUSP00000098026
Gene: ENSMUSG00000026646
AA Change: T67I

DomainStartEndE-ValueType
CHROMO 6 67 2e-7 SMART
Pfam:Pre-SET 110 207 1.3e-17 PFAM
SET 215 344 4.05e-41 SMART
PostSET 359 375 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100463
SMART Domains Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 6.5e-23 PFAM
low complexity region 476 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115066
SMART Domains Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Blast:Lactamase_B 25 70 1e-19 BLAST
Pfam:DRMBL 109 215 1.1e-22 PFAM
low complexity region 253 270 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
low complexity region 463 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127540
SMART Domains Protein: ENSMUSP00000125485
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149932
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Less than 5% of mice either heterozygous or homozygous for a reporter/null allele develop late-onset B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Suv39h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Suv39h2 APN 2 3464259 splice site probably benign
IGL03408:Suv39h2 APN 2 3459876 missense probably damaging 1.00
R0060:Suv39h2 UTSW 2 3464916 missense probably damaging 1.00
R0060:Suv39h2 UTSW 2 3464916 missense probably damaging 1.00
R0511:Suv39h2 UTSW 2 3472579 missense probably damaging 0.99
R1892:Suv39h2 UTSW 2 3459768 missense probably damaging 1.00
R1919:Suv39h2 UTSW 2 3464316 missense probably damaging 1.00
R5583:Suv39h2 UTSW 2 3474853 unclassified probably benign
R6770:Suv39h2 UTSW 2 3472551 missense possibly damaging 0.52
R6801:Suv39h2 UTSW 2 3464421 missense probably benign 0.16
R7607:Suv39h2 UTSW 2 3474829 missense unknown
R7914:Suv39h2 UTSW 2 3464416 nonsense probably null
X0062:Suv39h2 UTSW 2 3464785 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTAAAGGTGGGCCCTC -3'
(R):5'- GTGACTCTGTGCAGTTTGAATTAAG -3'

Sequencing Primer
(F):5'- CTCCAAGTCAACAGTGTTTTCAAC -3'
(R):5'- TGCAGTTTGAATTAAGAGAAGTGCC -3'
Posted On2015-04-30