Incidental Mutation 'R3888:Ano3'
ID 312853
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission 040800-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R3888 (G1)
Quality Score 209
Status Not validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110885000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Isoleucine at position 31 (K31I)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably damaging
Transcript: ENSMUST00000099623
AA Change: K31I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: K31I

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense possibly damaging 0.91
R9697:Ano3 UTSW 2 110665908 missense probably damaging 1.00
R9716:Ano3 UTSW 2 110771031 missense probably damaging 0.97
R9748:Ano3 UTSW 2 110658295 missense probably damaging 1.00
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGACCTCCCCTTTTCTGAG -3'
(R):5'- GTTAAAGGTTGACTCTTCCTTTGAC -3'

Sequencing Primer
(F):5'- GACCTCCCCTTTTCTGAGGAGAAAG -3'
(R):5'- GGTCTCTGACATGTTGCT -3'
Posted On 2015-04-30