Incidental Mutation 'R4026:Ces2g'
ID312988
Institutional Source Beutler Lab
Gene Symbol Ces2g
Ensembl Gene ENSMUSG00000031877
Gene Namecarboxylesterase 2G
Synonyms2210023G05Rik
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104961718-104969537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104964745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 171 (V171E)
Ref Sequence ENSEMBL: ENSMUSP00000049315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043183] [ENSMUST00000212820]
Predicted Effect probably damaging
Transcript: ENSMUST00000043183
AA Change: V171E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049315
Gene: ENSMUSG00000031877
AA Change: V171E

DomainStartEndE-ValueType
Pfam:COesterase 11 539 1.4e-176 PFAM
Pfam:Abhydrolase_3 144 245 4.9e-11 PFAM
Pfam:Peptidase_S9 159 331 8.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212330
Predicted Effect probably benign
Transcript: ENSMUST00000212820
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Ces2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ces2g APN 8 104967839 splice site probably benign
IGL00901:Ces2g APN 8 104965129 missense probably benign 0.01
IGL02101:Ces2g APN 8 104965137 splice site probably null
IGL02146:Ces2g APN 8 104966944 missense possibly damaging 0.94
IGL02624:Ces2g APN 8 104964748 missense probably damaging 1.00
IGL03091:Ces2g APN 8 104964754 missense probably damaging 1.00
PIT4810001:Ces2g UTSW 8 104964889 missense possibly damaging 0.52
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0122:Ces2g UTSW 8 104968300 missense probably damaging 0.96
R0494:Ces2g UTSW 8 104966567 missense probably benign
R1127:Ces2g UTSW 8 104967462 splice site probably null
R1337:Ces2g UTSW 8 104963965 missense possibly damaging 0.63
R1619:Ces2g UTSW 8 104967352 missense probably damaging 1.00
R1813:Ces2g UTSW 8 104966937 missense probably benign 0.32
R2240:Ces2g UTSW 8 104962502 missense probably benign 0.11
R2255:Ces2g UTSW 8 104967414 missense probably damaging 1.00
R2307:Ces2g UTSW 8 104968412 missense probably benign 0.01
R2566:Ces2g UTSW 8 104965989 critical splice donor site probably null
R4469:Ces2g UTSW 8 104965970 missense probably benign 0.14
R4631:Ces2g UTSW 8 104967462 splice site probably null
R4859:Ces2g UTSW 8 104967462 splice site probably null
R4900:Ces2g UTSW 8 104967357 nonsense probably null
R4925:Ces2g UTSW 8 104964894 missense probably benign 0.27
R5524:Ces2g UTSW 8 104966895 missense probably benign 0.00
R5556:Ces2g UTSW 8 104967442 missense probably benign 0.14
R6795:Ces2g UTSW 8 104967817 missense probably damaging 0.96
R6988:Ces2g UTSW 8 104963908 missense probably benign
R7653:Ces2g UTSW 8 104962653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTAGAGGACCCTTGCTGTG -3'
(R):5'- AAAGTGGGCGATGTTCTGC -3'

Sequencing Primer
(F):5'- ACCCTTGCTGTGGCCAAAG -3'
(R):5'- AGCCACTTGGTCCAGGAAC -3'
Posted On2015-04-30