Incidental Mutation 'R0387:Eml2'
ID31343
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Nameechinoderm microtubule associated protein like 2
Synonyms1600029N02Rik
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0387 (G1)
Quality Score202
Status Validated
Chromosome7
Chromosomal Location19176421-19206482 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 19182259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000141718] [ENSMUST00000141718] [ENSMUST00000144054] [ENSMUST00000148246]
Predicted Effect probably null
Transcript: ENSMUST00000048502
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083609
Predicted Effect probably null
Transcript: ENSMUST00000117338
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117338
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120595
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141718
Predicted Effect probably null
Transcript: ENSMUST00000141718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141792
Predicted Effect probably null
Transcript: ENSMUST00000144054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146095
Predicted Effect probably benign
Transcript: ENSMUST00000148246
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 unclassified probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 unclassified probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
R7706:Eml2 UTSW 7 19186110 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCACCTGTTCAGAAAGGAAGATGG -3'
(R):5'- AAGGATACACCCAGTCTAGCTTTAGCC -3'

Sequencing Primer
(F):5'- aaagaagagagaaggaaagggg -3'
(R):5'- GTCCCCGCAGAAACATCTTTA -3'
Posted On2013-04-24