Incidental Mutation 'R7045:Eml2'
ID547249
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Nameechinoderm microtubule associated protein like 2
Synonyms1600029N02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7045 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19176421-19206482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19201579 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 638 (D638G)
Ref Sequence ENSEMBL: ENSMUSP00000112491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]
Predicted Effect probably damaging
Transcript: ENSMUST00000048502
AA Change: D465G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: D465G

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117338
AA Change: D638G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: D638G

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120595
AA Change: D446G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: D446G

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect silent
Transcript: ENSMUST00000148246
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt1 A T 12: 112,662,301 Y18* probably null Het
Ank2 C A 3: 127,012,744 A583S probably damaging Het
Atp8b4 T C 2: 126,372,195 N706S probably benign Het
Bace2 A G 16: 97,399,665 N111S probably damaging Het
Cnp A T 11: 100,580,358 R275S probably benign Het
Cs T A 10: 128,352,717 M104K probably benign Het
Ctcfl G A 2: 173,112,374 T310I probably damaging Het
Cyp2d40 T C 15: 82,761,562 I81V probably benign Het
Ddx19a A G 8: 110,993,074 V30A probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dock6 G A 9: 21,821,811 A1062V probably damaging Het
Dpysl2 T C 14: 66,829,946 D172G probably benign Het
Epb41l4b C A 4: 57,103,522 A105S possibly damaging Het
Fam198a T C 9: 121,965,641 L287P probably damaging Het
Fat4 A G 3: 38,888,601 I548V probably benign Het
Gabrb2 G A 11: 42,593,931 A272T probably damaging Het
Hcn1 C T 13: 117,975,462 P654L unknown Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hk1 C A 10: 62,286,570 G477C probably damaging Het
Hspa5 C T 2: 34,773,192 P127L probably damaging Het
Kiss1r A G 10: 79,919,425 probably null Het
L3mbtl4 G T 17: 68,461,566 R223L probably benign Het
Loxl4 G T 19: 42,606,635 N200K probably damaging Het
Lrba T C 3: 86,285,091 V104A probably benign Het
Lyst T A 13: 13,634,900 V385D probably benign Het
Lyst T A 13: 13,637,708 C902S probably damaging Het
Mrpl28 T C 17: 26,126,287 F227S probably benign Het
Mtmr3 A T 11: 4,498,896 V289E possibly damaging Het
Ndst3 A G 3: 123,672,083 V80A probably damaging Het
Nid2 C T 14: 19,779,681 A680V possibly damaging Het
Nudcd1 T C 15: 44,405,830 N145D probably benign Het
Nup210 A T 6: 91,054,451 I812N probably damaging Het
Olfr1008 A G 2: 85,689,911 S161G possibly damaging Het
Olfr130 C T 17: 38,067,971 H267Y probably benign Het
Olfr1390 A T 11: 49,340,930 T133S probably damaging Het
Olfr1468-ps1 C A 19: 13,374,972 N3K probably damaging Het
Olfr251 T A 9: 38,378,433 M184K probably damaging Het
Olfr319 A T 11: 58,701,669 probably benign Het
Olfr503 A G 7: 108,545,245 K238R probably damaging Het
Pcdhb6 A C 18: 37,336,276 Q750P possibly damaging Het
Plppr4 T C 3: 117,360,034 Y72C probably damaging Het
Rasgrf2 G T 13: 92,022,592 probably benign Het
Sbk2 A G 7: 4,958,906 I127T probably damaging Het
Smchd1 A C 17: 71,415,044 S817A probably benign Het
Speer4b A T 5: 27,500,125 N83K probably damaging Het
Strc A T 2: 121,370,726 L1296Q probably damaging Het
Svs1 T C 6: 48,988,612 V518A possibly damaging Het
Thap11 C A 8: 105,855,583 R75S possibly damaging Het
Unc13a A C 8: 71,658,763 L268R possibly damaging Het
Zfp39 A T 11: 58,890,443 C498S unknown Het
Zfp507 T C 7: 35,795,553 T22A possibly damaging Het
Zfp85 T C 13: 67,749,593 Y120C probably benign Het
Zfp882 G A 8: 71,913,249 probably null Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 unclassified probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 unclassified probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
R7706:Eml2 UTSW 7 19186110 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CATCTCAGCCTGTCACACAG -3'
(R):5'- TATGAGGAAGCACCCAGACTCC -3'

Sequencing Primer
(F):5'- TGTCACACAGCCTGGCCTC -3'
(R):5'- CTGGTGAAAAGCTGACCA -3'
Posted On2019-05-13