Incidental Mutation 'R4133:Sirt1'
ID314751
Institutional Source Beutler Lab
Gene Symbol Sirt1
Ensembl Gene ENSMUSG00000020063
Gene Namesirtuin 1
SynonymsSir2, Sir2alpha
MMRRC Submission 041637-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4133 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63319005-63381704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63335659 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 209 (I209V)
Ref Sequence ENSEMBL: ENSMUSP00000101082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020257] [ENSMUST00000105442] [ENSMUST00000120239] [ENSMUST00000146028] [ENSMUST00000177694] [ENSMUST00000177694]
Predicted Effect probably null
Transcript: ENSMUST00000020257
AA Change: I248V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020257
Gene: ENSMUSG00000020063
AA Change: I248V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 1.3e-62 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105442
AA Change: I209V

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101082
Gene: ENSMUSG00000020063
AA Change: I209V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
Pfam:SIR2 214 400 4e-63 PFAM
PDB:4KXQ|B 590 609 3e-6 PDB
low complexity region 610 628 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120239
AA Change: I248V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112595
Gene: ENSMUSG00000020063
AA Change: I248V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 6.5e-64 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131371
Predicted Effect possibly damaging
Transcript: ENSMUST00000146028
AA Change: I78V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117819
Gene: ENSMUSG00000020063
AA Change: I78V

DomainStartEndE-ValueType
Pfam:SIR2 83 140 1.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177694
AA Change: I248V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137565
Gene: ENSMUSG00000020063
AA Change: I248V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 7.3e-63 PFAM
low complexity region 465 483 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177694
AA Change: I248V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137565
Gene: ENSMUSG00000020063
AA Change: I248V

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 7.3e-63 PFAM
low complexity region 465 483 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
Meta Mutation Damage Score 0.2580 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: This gene encodes a member of the sirtuin family of proteins, characterized by their deacetylase activity and proposed role in longevity. The encoded protein regulates gene expression in a wide range of cell and tissue types through its NAD+-dependent deacetylation of histones, transcription factors and transcriptional coactivators. Brain-specific overexpression of this gene has been shown to result in increased median lifespan. Viability of homozygous knockout mice for this gene varies with strain background. Homozygous knockout mice of strains that do not exhibit embryonic lethality are sterile and have a reduced lifespan. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic and fetal lethality, abnormal embryogenesis, and abnormal cellular phenotypes of derived MEFs. Mice homozygous for other knock-out alleles may exhibit peri- and postnatal lethality and heart, mammary gland, eye, and reproductive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,769,998 noncoding transcript Het
Aldh3b1 A G 19: 3,920,808 I184T probably damaging Het
Arhgap42 C T 9: 9,011,299 probably benign Het
Arhgef4 A G 1: 34,806,104 D1463G probably damaging Het
Arpc5 A G 1: 152,768,871 T52A probably benign Het
Asb6 A G 2: 30,828,235 probably benign Het
Ash1l T C 3: 88,982,260 V482A probably benign Het
Bop1 T C 15: 76,454,335 N469S probably benign Het
Btaf1 T A 19: 36,961,738 N266K probably benign Het
Btla T C 16: 45,239,298 Y122H probably damaging Het
Cacna1g A G 11: 94,432,544 M1278T probably damaging Het
Cdc42bpb A G 12: 111,321,542 S524P probably benign Het
Cep78 A G 19: 15,969,155 S438P probably damaging Het
Clca4a T G 3: 144,969,352 E171D probably benign Het
Cldn6 A T 17: 23,681,493 I144F probably damaging Het
Cpd G A 11: 76,814,818 Q363* probably null Het
Cpn1 G A 19: 43,986,284 P2L possibly damaging Het
Ddx31 A G 2: 28,858,852 D264G probably damaging Het
Ddx39b C T 17: 35,253,089 S368L probably damaging Het
Ddx60 A G 8: 61,972,220 K681E probably damaging Het
Dennd1c A C 17: 57,076,980 W15G possibly damaging Het
Dgkd T G 1: 87,941,501 probably null Het
Dnah7c G T 1: 46,665,990 A2388S probably benign Het
Etv4 C A 11: 101,770,498 K442N probably damaging Het
Fam234a T C 17: 26,213,558 D539G probably damaging Het
Fam71a A T 1: 191,163,008 N479K probably benign Het
Fancm A G 12: 65,120,530 T1538A probably benign Het
Fbn2 A T 18: 58,095,962 N725K possibly damaging Het
Fcer2a T A 8: 3,691,130 N4I possibly damaging Het
Fgd5 T C 6: 92,069,437 V1229A probably damaging Het
Gm5471 A T 15: 44,971,901 noncoding transcript Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm6729 C A 10: 86,541,166 noncoding transcript Het
Hectd4 G T 5: 121,277,834 probably null Het
Hspb3 A C 13: 113,663,491 M1R probably null Het
Igkv10-95 T C 6: 68,680,617 V19A probably damaging Het
Il1rap A G 16: 26,722,886 S626G probably benign Het
Ints9 A G 14: 64,990,554 H103R probably benign Het
Itga4 T A 2: 79,322,652 D894E probably damaging Het
Khsrp T C 17: 57,025,605 H225R probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lama1 A T 17: 67,812,486 I2653F probably damaging Het
Map4k5 A T 12: 69,845,723 L144Q probably damaging Het
Mcm5 A G 8: 75,115,854 Y252C probably damaging Het
Mmgt2 A G 11: 62,665,051 E75G probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Nckap5 A G 1: 126,222,706 V162A probably benign Het
Nr3c2 T C 8: 76,909,749 I493T probably damaging Het
Olfr1411 T C 1: 92,596,743 F75L probably benign Het
Olfr325 A T 11: 58,581,075 Y77F probably damaging Het
Olfr698 A C 7: 106,753,079 L103R probably damaging Het
Papola A G 12: 105,799,658 T6A possibly damaging Het
Ppp1cc G A 5: 122,168,226 R36Q probably benign Het
Ptpro G T 6: 137,420,372 W81C probably damaging Het
Rasgrf2 A G 13: 91,982,654 S162P possibly damaging Het
Rpusd2 T C 2: 119,038,715 S540P probably damaging Het
Scn5a T A 9: 119,486,372 T1757S probably damaging Het
Setbp1 T C 18: 78,856,991 I1154V probably benign Het
Slco6c1 T A 1: 97,081,493 I406L probably benign Het
Smc2 A G 4: 52,450,947 E255G probably damaging Het
Snap91 C A 9: 86,777,049 G477V probably damaging Het
Speg A G 1: 75,427,904 Q2780R probably benign Het
Ssh2 A G 11: 77,421,269 Y196C probably damaging Het
Ssxb9 A T X: 8,369,606 T18S probably damaging Het
Stxbp5l T C 16: 37,208,119 I527M possibly damaging Het
Tex10 T C 4: 48,468,968 Y69C probably damaging Het
Theg T C 10: 79,580,050 T236A probably damaging Het
Thoc3 T C 13: 54,468,548 D87G probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trps1 T C 15: 50,831,387 K213R probably damaging Het
Uggt1 A T 1: 36,158,159 L1221Q probably damaging Het
Vmn2r3 T A 3: 64,275,717 Y187F probably damaging Het
Washc2 G A 6: 116,258,930 E1121K probably damaging Het
Zfx T C X: 94,080,858 N360D probably damaging Het
Znhit3 A G 11: 84,916,313 V10A probably benign Het
Other mutations in Sirt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Sirt1 APN 10 63325203 missense probably damaging 1.00
IGL02106:Sirt1 APN 10 63335829 missense probably damaging 1.00
PIT4283001:Sirt1 UTSW 10 63321786 missense probably benign 0.02
R0658:Sirt1 UTSW 10 63321736 unclassified probably benign
R0724:Sirt1 UTSW 10 63323973 missense possibly damaging 0.82
R1653:Sirt1 UTSW 10 63321809 missense probably benign
R1831:Sirt1 UTSW 10 63320646 missense probably benign 0.13
R4250:Sirt1 UTSW 10 63337098 critical splice acceptor site probably null
R4378:Sirt1 UTSW 10 63338949 missense probably benign 0.00
R4396:Sirt1 UTSW 10 63321998 missense probably benign 0.00
R4776:Sirt1 UTSW 10 63335722 missense probably benign 0.17
R4898:Sirt1 UTSW 10 63322004 missense probably benign 0.35
R7151:Sirt1 UTSW 10 63323996 missense probably damaging 1.00
R7365:Sirt1 UTSW 10 63322003 missense probably benign
R7467:Sirt1 UTSW 10 63322150 missense probably benign 0.00
R7773:Sirt1 UTSW 10 63326783 missense possibly damaging 0.75
R8729:Sirt1 UTSW 10 63320926 missense probably damaging 1.00
RF015:Sirt1 UTSW 10 63337016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATAATTCCACTTACCAATTGTTC -3'
(R):5'- CCGATCCTCGAACAATTCTTAAAG -3'

Sequencing Primer
(F):5'- CAAAGGCTACATCAAGAGC -3'
(R):5'- ATGATATGACGCTGTGGC -3'
Posted On2015-05-14