Mutagenetix > Incidental Mutation

Incidental Mutation 'R4133:Ints9'

314769

Institutional Source

Beutler Lab

Gene Symbol

Ints9

Ensembl Gene

ENSMUSG00000021975

Gene Name

integrator complex subunit 9

Synonyms

D14Ertd231e

MMRRC Submission

041637-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4133 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64950045-65039832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64990554 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 103 (H103R)

Ref Sequence

ENSEMBL: ENSMUSP00000045552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043914]

AlphaFold

Q8K114

Predicted Effect

probably benign
Transcript: ENSMUST00000043914
AA Change: H103R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: H103R

Domain	Start	End	E-Value	Type
Pfam:Lactamase_B_6	91	289	1.2e-17	PFAM
Beta-Casp	334	462	7.65e-16	SMART
low complexity region	583	596	N/A	INTRINSIC
low complexity region	672	682	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225790

Meta Mutation Damage Score

0.0702

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	T	A	9: 60,769,998		noncoding transcript	Het
Aldh3b1	A	G	19: 3,920,808	I184T	probably damaging	Het
Arhgap42	C	T	9: 9,011,299		probably benign	Het
Arhgef4	A	G	1: 34,806,104	D1463G	probably damaging	Het
Arpc5	A	G	1: 152,768,871	T52A	probably benign	Het
Asb6	A	G	2: 30,828,235		probably benign	Het
Ash1l	T	C	3: 88,982,260	V482A	probably benign	Het
Bop1	T	C	15: 76,454,335	N469S	probably benign	Het
Btaf1	T	A	19: 36,961,738	N266K	probably benign	Het
Btla	T	C	16: 45,239,298	Y122H	probably damaging	Het
Cacna1g	A	G	11: 94,432,544	M1278T	probably damaging	Het
Cdc42bpb	A	G	12: 111,321,542	S524P	probably benign	Het
Cep78	A	G	19: 15,969,155	S438P	probably damaging	Het
Clca4a	T	G	3: 144,969,352	E171D	probably benign	Het
Cldn6	A	T	17: 23,681,493	I144F	probably damaging	Het
Cpd	G	A	11: 76,814,818	Q363*	probably null	Het
Cpn1	G	A	19: 43,986,284	P2L	possibly damaging	Het
Ddx31	A	G	2: 28,858,852	D264G	probably damaging	Het
Ddx39b	C	T	17: 35,253,089	S368L	probably damaging	Het
Ddx60	A	G	8: 61,972,220	K681E	probably damaging	Het
Dennd1c	A	C	17: 57,076,980	W15G	possibly damaging	Het
Dgkd	T	G	1: 87,941,501		probably null	Het
Dnah7c	G	T	1: 46,665,990	A2388S	probably benign	Het
Etv4	C	A	11: 101,770,498	K442N	probably damaging	Het
Fam234a	T	C	17: 26,213,558	D539G	probably damaging	Het
Fam71a	A	T	1: 191,163,008	N479K	probably benign	Het
Fancm	A	G	12: 65,120,530	T1538A	probably benign	Het
Fbn2	A	T	18: 58,095,962	N725K	possibly damaging	Het
Fcer2a	T	A	8: 3,691,130	N4I	possibly damaging	Het
Fgd5	T	C	6: 92,069,437	V1229A	probably damaging	Het
Gm5471	A	T	15: 44,971,901		noncoding transcript	Het
Gm5478	T	A	15: 101,644,645	I331F	probably damaging	Het
Gm6729	C	A	10: 86,541,166		noncoding transcript	Het
Hectd4	G	T	5: 121,277,834		probably null	Het
Hspb3	A	C	13: 113,663,491	M1R	probably null	Het
Igkv10-95	T	C	6: 68,680,617	V19A	probably damaging	Het
Il1rap	A	G	16: 26,722,886	S626G	probably benign	Het
Itga4	T	A	2: 79,322,652	D894E	probably damaging	Het
Khsrp	T	C	17: 57,025,605	H225R	probably benign	Het
Lama1	T	C	17: 67,750,655	Y575H	probably damaging	Het
Lama1	A	T	17: 67,812,486	I2653F	probably damaging	Het
Map4k5	A	T	12: 69,845,723	L144Q	probably damaging	Het
Mcm5	A	G	8: 75,115,854	Y252C	probably damaging	Het
Mmgt2	A	G	11: 62,665,051	E75G	probably damaging	Het
Mroh2a	A	T	1: 88,254,965	N1205I	possibly damaging	Het
Nckap5	A	G	1: 126,222,706	V162A	probably benign	Het
Nr3c2	T	C	8: 76,909,749	I493T	probably damaging	Het
Olfr1411	T	C	1: 92,596,743	F75L	probably benign	Het
Olfr325	A	T	11: 58,581,075	Y77F	probably damaging	Het
Olfr698	A	C	7: 106,753,079	L103R	probably damaging	Het
Papola	A	G	12: 105,799,658	T6A	possibly damaging	Het
Ppp1cc	G	A	5: 122,168,226	R36Q	probably benign	Het
Ptpro	G	T	6: 137,420,372	W81C	probably damaging	Het
Rasgrf2	A	G	13: 91,982,654	S162P	possibly damaging	Het
Rpusd2	T	C	2: 119,038,715	S540P	probably damaging	Het
Scn5a	T	A	9: 119,486,372	T1757S	probably damaging	Het
Setbp1	T	C	18: 78,856,991	I1154V	probably benign	Het
Sirt1	T	C	10: 63,335,659	I209V	probably null	Het
Slco6c1	T	A	1: 97,081,493	I406L	probably benign	Het
Smc2	A	G	4: 52,450,947	E255G	probably damaging	Het
Snap91	C	A	9: 86,777,049	G477V	probably damaging	Het
Speg	A	G	1: 75,427,904	Q2780R	probably benign	Het
Ssh2	A	G	11: 77,421,269	Y196C	probably damaging	Het
Ssxb9	A	T	X: 8,369,606	T18S	probably damaging	Het
Stxbp5l	T	C	16: 37,208,119	I527M	possibly damaging	Het
Tex10	T	C	4: 48,468,968	Y69C	probably damaging	Het
Theg	T	C	10: 79,580,050	T236A	probably damaging	Het
Thoc3	T	C	13: 54,468,548	D87G	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trps1	T	C	15: 50,831,387	K213R	probably damaging	Het
Uggt1	A	T	1: 36,158,159	L1221Q	probably damaging	Het
Vmn2r3	T	A	3: 64,275,717	Y187F	probably damaging	Het
Washc2	G	A	6: 116,258,930	E1121K	probably damaging	Het
Zfx	T	C	X: 94,080,858	N360D	probably damaging	Het
Znhit3	A	G	11: 84,916,313	V10A	probably benign	Het

Other mutations in Ints9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Ints9	APN	14	65037421	missense	probably benign	0.00
IGL02374:Ints9	APN	14	65039333	missense	probably benign	0.00
IGL02728:Ints9	APN	14	64993008	missense	probably damaging	1.00
IGL02992:Ints9	APN	14	64980164	missense	probably benign	0.08
IGL03151:Ints9	APN	14	65032340	missense	possibly damaging	0.86
R0437:Ints9	UTSW	14	64986369	splice site	probably benign
R0582:Ints9	UTSW	14	64980149	missense	probably damaging	1.00
R1525:Ints9	UTSW	14	64995011	missense	probably benign	0.05
R1569:Ints9	UTSW	14	64980122	missense	possibly damaging	0.91
R1835:Ints9	UTSW	14	65032256	missense	probably damaging	1.00
R1839:Ints9	UTSW	14	65016530	missense	probably damaging	1.00
R1862:Ints9	UTSW	14	65026413	missense	probably benign
R1892:Ints9	UTSW	14	65020423	missense	probably benign	0.08
R2146:Ints9	UTSW	14	64986343	missense	possibly damaging	0.71
R2285:Ints9	UTSW	14	65007997	missense	possibly damaging	0.61
R3015:Ints9	UTSW	14	64950278	missense	probably benign	0.00
R4180:Ints9	UTSW	14	64992981	missense	probably damaging	1.00
R4509:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4510:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4511:Ints9	UTSW	14	65028932	missense	possibly damaging	0.96
R4608:Ints9	UTSW	14	65032280	missense	possibly damaging	0.82
R5023:Ints9	UTSW	14	64980228	missense	probably damaging	1.00
R5117:Ints9	UTSW	14	64993091	nonsense	probably null
R5261:Ints9	UTSW	14	65008072	missense	probably benign	0.25
R5582:Ints9	UTSW	14	65028896	missense	possibly damaging	0.83
R5990:Ints9	UTSW	14	65039328	missense	probably damaging	1.00
R6009:Ints9	UTSW	14	65008082	missense	probably benign	0.43
R6241:Ints9	UTSW	14	64980210	missense	possibly damaging	0.90
R6351:Ints9	UTSW	14	64993007	missense	probably damaging	0.98
R6821:Ints9	UTSW	14	65037458	missense	probably benign	0.20
R7422:Ints9	UTSW	14	65032298	missense	possibly damaging	0.93
R7442:Ints9	UTSW	14	64995064	nonsense	probably null
R7475:Ints9	UTSW	14	65026465	missense	probably null	0.23
R8183:Ints9	UTSW	14	65036453	missense	probably damaging	0.98
R8223:Ints9	UTSW	14	65020360	missense	possibly damaging	0.94
R8282:Ints9	UTSW	14	65007308	missense	probably benign	0.00
R8314:Ints9	UTSW	14	65029030	missense	probably damaging	1.00
R8341:Ints9	UTSW	14	65036414	missense	probably benign	0.14
R8548:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9356:Ints9	UTSW	14	65032321	missense	probably benign	0.39
R9434:Ints9	UTSW	14	65008057	missense	probably benign	0.00
Z1176:Ints9	UTSW	14	65037454	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGTTTTCACCCTCAGTCGG -3'
(R):5'- GAAGGTTGCAAGAGTCAGTGCC -3'

Sequencing Primer
(F):5'- ACCCTCTCAGTTAGGTGAG -3'
(R):5'- AGAGTCAGTGCCATCTCTGATAC -3'

Posted On

2015-05-14