Incidental Mutation 'R4133:Olfr325'
ID314754
Institutional Source Beutler Lab
Gene Symbol Olfr325
Ensembl Gene ENSMUSG00000060765
Gene Nameolfactory receptor 325
SynonymsMOR275-5, MOR275-11_p, GA_x6K02T2NKPP-844642-843680
MMRRC Submission 041637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4133 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58577730-58582365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58581075 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 77 (Y77F)
Ref Sequence ENSEMBL: ENSMUSP00000145386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169428] [ENSMUST00000203418]
Predicted Effect probably damaging
Transcript: ENSMUST00000169428
AA Change: Y77F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131257
Gene: ENSMUSG00000060765
AA Change: Y77F

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 290 1.4e-6 PFAM
Pfam:7tm_1 45 294 1.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203418
AA Change: Y77F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145386
Gene: ENSMUSG00000060765
AA Change: Y77F

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 7.6e-14 PFAM
Pfam:7TM_GPCR_Srsx 36 130 1.1e-4 PFAM
Pfam:7tm_1 45 130 2.6e-16 PFAM
Meta Mutation Damage Score 0.4039 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,769,998 noncoding transcript Het
Aldh3b1 A G 19: 3,920,808 I184T probably damaging Het
Arhgap42 C T 9: 9,011,299 probably benign Het
Arhgef4 A G 1: 34,806,104 D1463G probably damaging Het
Arpc5 A G 1: 152,768,871 T52A probably benign Het
Asb6 A G 2: 30,828,235 probably benign Het
Ash1l T C 3: 88,982,260 V482A probably benign Het
Bop1 T C 15: 76,454,335 N469S probably benign Het
Btaf1 T A 19: 36,961,738 N266K probably benign Het
Btla T C 16: 45,239,298 Y122H probably damaging Het
Cacna1g A G 11: 94,432,544 M1278T probably damaging Het
Cdc42bpb A G 12: 111,321,542 S524P probably benign Het
Cep78 A G 19: 15,969,155 S438P probably damaging Het
Clca4a T G 3: 144,969,352 E171D probably benign Het
Cldn6 A T 17: 23,681,493 I144F probably damaging Het
Cpd G A 11: 76,814,818 Q363* probably null Het
Cpn1 G A 19: 43,986,284 P2L possibly damaging Het
Ddx31 A G 2: 28,858,852 D264G probably damaging Het
Ddx39b C T 17: 35,253,089 S368L probably damaging Het
Ddx60 A G 8: 61,972,220 K681E probably damaging Het
Dennd1c A C 17: 57,076,980 W15G possibly damaging Het
Dgkd T G 1: 87,941,501 probably null Het
Dnah7c G T 1: 46,665,990 A2388S probably benign Het
Etv4 C A 11: 101,770,498 K442N probably damaging Het
Fam234a T C 17: 26,213,558 D539G probably damaging Het
Fam71a A T 1: 191,163,008 N479K probably benign Het
Fancm A G 12: 65,120,530 T1538A probably benign Het
Fbn2 A T 18: 58,095,962 N725K possibly damaging Het
Fcer2a T A 8: 3,691,130 N4I possibly damaging Het
Fgd5 T C 6: 92,069,437 V1229A probably damaging Het
Gm5471 A T 15: 44,971,901 noncoding transcript Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm6729 C A 10: 86,541,166 noncoding transcript Het
Hectd4 G T 5: 121,277,834 probably null Het
Hspb3 A C 13: 113,663,491 M1R probably null Het
Igkv10-95 T C 6: 68,680,617 V19A probably damaging Het
Il1rap A G 16: 26,722,886 S626G probably benign Het
Ints9 A G 14: 64,990,554 H103R probably benign Het
Itga4 T A 2: 79,322,652 D894E probably damaging Het
Khsrp T C 17: 57,025,605 H225R probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lama1 A T 17: 67,812,486 I2653F probably damaging Het
Map4k5 A T 12: 69,845,723 L144Q probably damaging Het
Mcm5 A G 8: 75,115,854 Y252C probably damaging Het
Mmgt2 A G 11: 62,665,051 E75G probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Nckap5 A G 1: 126,222,706 V162A probably benign Het
Nr3c2 T C 8: 76,909,749 I493T probably damaging Het
Olfr1411 T C 1: 92,596,743 F75L probably benign Het
Olfr698 A C 7: 106,753,079 L103R probably damaging Het
Papola A G 12: 105,799,658 T6A possibly damaging Het
Ppp1cc G A 5: 122,168,226 R36Q probably benign Het
Ptpro G T 6: 137,420,372 W81C probably damaging Het
Rasgrf2 A G 13: 91,982,654 S162P possibly damaging Het
Rpusd2 T C 2: 119,038,715 S540P probably damaging Het
Scn5a T A 9: 119,486,372 T1757S probably damaging Het
Setbp1 T C 18: 78,856,991 I1154V probably benign Het
Sirt1 T C 10: 63,335,659 I209V probably null Het
Slco6c1 T A 1: 97,081,493 I406L probably benign Het
Smc2 A G 4: 52,450,947 E255G probably damaging Het
Snap91 C A 9: 86,777,049 G477V probably damaging Het
Speg A G 1: 75,427,904 Q2780R probably benign Het
Ssh2 A G 11: 77,421,269 Y196C probably damaging Het
Ssxb9 A T X: 8,369,606 T18S probably damaging Het
Stxbp5l T C 16: 37,208,119 I527M possibly damaging Het
Tex10 T C 4: 48,468,968 Y69C probably damaging Het
Theg T C 10: 79,580,050 T236A probably damaging Het
Thoc3 T C 13: 54,468,548 D87G probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trps1 T C 15: 50,831,387 K213R probably damaging Het
Uggt1 A T 1: 36,158,159 L1221Q probably damaging Het
Vmn2r3 T A 3: 64,275,717 Y187F probably damaging Het
Washc2 G A 6: 116,258,930 E1121K probably damaging Het
Zfx T C X: 94,080,858 N360D probably damaging Het
Znhit3 A G 11: 84,916,313 V10A probably benign Het
Other mutations in Olfr325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr325 APN 11 58581810 missense probably benign
IGL01922:Olfr325 APN 11 58581073 missense probably benign 0.01
IGL02440:Olfr325 APN 11 58581209 missense probably damaging 1.00
IGL02456:Olfr325 APN 11 58581198 missense possibly damaging 0.48
IGL03088:Olfr325 APN 11 58581827 utr 3 prime probably benign
IGL03328:Olfr325 APN 11 58581713 missense probably damaging 1.00
R0604:Olfr325 UTSW 11 58581348 missense probably damaging 0.99
R1698:Olfr325 UTSW 11 58581251 missense probably damaging 1.00
R2473:Olfr325 UTSW 11 58581575 missense probably damaging 1.00
R2888:Olfr325 UTSW 11 58581162 missense possibly damaging 0.96
R4710:Olfr325 UTSW 11 58581722 missense probably damaging 1.00
R4715:Olfr325 UTSW 11 58581429 missense probably damaging 1.00
R4898:Olfr325 UTSW 11 58581720 missense probably damaging 1.00
R4939:Olfr325 UTSW 11 58581211 missense probably damaging 1.00
R4977:Olfr325 UTSW 11 58581629 missense possibly damaging 0.57
R5389:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R5393:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R6137:Olfr325 UTSW 11 58581068 missense probably benign
R6302:Olfr325 UTSW 11 58581638 missense probably benign
R6655:Olfr325 UTSW 11 58581210 missense probably damaging 1.00
R6927:Olfr325 UTSW 11 58581665 missense possibly damaging 0.81
R7451:Olfr325 UTSW 11 58581690 missense probably damaging 1.00
R7494:Olfr325 UTSW 11 58581212 missense probably damaging 0.97
R7626:Olfr325 UTSW 11 58581173 missense probably damaging 0.97
R7724:Olfr325 UTSW 11 58581382 missense probably benign 0.01
R7874:Olfr325 UTSW 11 58581747 missense possibly damaging 0.93
R8217:Olfr325 UTSW 11 58580966 missense probably benign 0.00
R8252:Olfr325 UTSW 11 58581132 missense probably damaging 1.00
Z1177:Olfr325 UTSW 11 58581311 missense probably damaging 1.00
Z1186:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1186:Olfr325 UTSW 11 58580931 missense probably benign
Z1186:Olfr325 UTSW 11 58581002 missense probably benign
Z1186:Olfr325 UTSW 11 58581296 missense probably benign
Z1186:Olfr325 UTSW 11 58581657 missense probably benign
Z1187:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1187:Olfr325 UTSW 11 58580931 missense probably benign
Z1187:Olfr325 UTSW 11 58581002 missense probably benign
Z1187:Olfr325 UTSW 11 58581296 missense probably benign
Z1187:Olfr325 UTSW 11 58581657 missense probably benign
Z1188:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1188:Olfr325 UTSW 11 58580931 missense probably benign
Z1188:Olfr325 UTSW 11 58581002 missense probably benign
Z1188:Olfr325 UTSW 11 58581296 missense probably benign
Z1188:Olfr325 UTSW 11 58581657 missense probably benign
Z1189:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1189:Olfr325 UTSW 11 58580931 missense probably benign
Z1189:Olfr325 UTSW 11 58581296 missense probably benign
Z1189:Olfr325 UTSW 11 58581657 missense probably benign
Z1190:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1190:Olfr325 UTSW 11 58580931 missense probably benign
Z1190:Olfr325 UTSW 11 58581002 missense probably benign
Z1190:Olfr325 UTSW 11 58581296 missense probably benign
Z1190:Olfr325 UTSW 11 58581657 missense probably benign
Z1191:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1191:Olfr325 UTSW 11 58580931 missense probably benign
Z1191:Olfr325 UTSW 11 58581002 missense probably benign
Z1191:Olfr325 UTSW 11 58581296 missense probably benign
Z1191:Olfr325 UTSW 11 58581657 missense probably benign
Z1192:Olfr325 UTSW 11 58580924 missense probably benign 0.00
Z1192:Olfr325 UTSW 11 58580931 missense probably benign
Z1192:Olfr325 UTSW 11 58581296 missense probably benign
Z1192:Olfr325 UTSW 11 58581657 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACAGTCAGATTTCACCCTG -3'
(R):5'- CACACCCTGTGGTTCATGAG -3'

Sequencing Primer
(F):5'- GGTGGGATTCTTCAGTCAATCCAAAC -3'
(R):5'- ACCCTGTGGTTCATGAGGACAG -3'
Posted On2015-05-14