Mutagenetix > Incidental Mutations

Incidental Mutation 'R4088:Ubtfl1'

317469

Institutional Source

Beutler Lab

Gene Symbol

Ubtfl1

Ensembl Gene

ENSMUSG00000074502

Gene Name

upstream binding transcription factor, RNA polymerase I-like 1

Synonyms

Hmgpi, B020006M18Rik

MMRRC Submission

040981-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R4088 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18404418-18413177 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18409968 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 264 (V264A)

Ref Sequence

ENSEMBL: ENSMUSP00000126540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098973] [ENSMUST00000164441] [ENSMUST00000169398]

Predicted Effect

probably damaging
Transcript: ENSMUST00000098973
AA Change: V264A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096572
Gene: ENSMUSG00000074502
AA Change: V264A

Domain	Start	End	E-Value	Type
Blast:SANT	6	64	1e-17	BLAST
HMG	100	170	5.61e-16	SMART
HMG	224	292	3.79e-4	SMART
low complexity region	297	307	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164441
AA Change: V264A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000129611
Gene: ENSMUSG00000074502
AA Change: V264A

Domain	Start	End	E-Value	Type
Blast:SANT	6	64	1e-17	BLAST
HMG	100	170	5.61e-16	SMART
HMG	224	292	3.79e-4	SMART
low complexity region	297	307	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169398
AA Change: V264A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126540
Gene: ENSMUSG00000074502
AA Change: V264A

Domain	Start	End	E-Value	Type
Blast:SANT	6	64	1e-17	BLAST
HMG	100	170	5.61e-16	SMART
HMG	224	292	3.79e-4	SMART
low complexity region	297	307	N/A	INTRINSIC
low complexity region	373	394	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

96% (55/57)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	T	C	1: 181,227,709		noncoding transcript	Het
Alox12b	G	T	11: 69,158,385	V87L	probably benign	Het
Arsk	T	G	13: 76,098,414	N32T	probably benign	Het
Baz1b	T	A	5: 135,216,940	N414K	probably damaging	Het
Cacna1e	A	T	1: 154,412,183		probably null	Het
Cdc73	A	G	1: 143,608,514		probably benign	Het
Cdhr2	A	G	13: 54,717,888	D233G	probably null	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Col4a4	T	A	1: 82,523,922	Y370F	unknown	Het
Cyp2b9	T	C	7: 26,173,456	L8P	probably damaging	Het
Ddx4	A	G	13: 112,613,761	V386A	probably benign	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Dnajc6	T	A	4: 101,639,396	V920E	probably damaging	Het
Eef2kmt	A	T	16: 5,253,035	I50N	probably damaging	Het
Esyt3	T	C	9: 99,324,237	M40V	probably benign	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gpr26	G	T	7: 131,967,076	C50F	probably benign	Het
Hmcn1	A	G	1: 150,703,216	I1993T	possibly damaging	Het
Hsdl2	T	A	4: 59,610,636	L211Q	unknown	Het
Khdrbs2	A	G	1: 32,333,524	E93G	probably damaging	Het
Kif13b	T	C	14: 64,767,455		probably null	Het
Kif15	T	A	9: 122,986,189	L423I	probably benign	Het
Kmt2c	A	G	5: 25,287,713	V834A	probably benign	Het
Lama3	T	A	18: 12,504,308	Y28*	probably null	Het
Map4k2	A	T	19: 6,353,156	H763L	probably damaging	Het
Mkl2	T	C	16: 13,384,200	F120S	probably damaging	Het
Ndufs3	C	T	2: 90,898,345		probably benign	Het
Nfasc	A	T	1: 132,595,591	V887E	probably damaging	Het
Npsr1	G	A	9: 24,313,769	E358K	possibly damaging	Het
Nrcam	T	C	12: 44,572,202	L828P	possibly damaging	Het
Olfr344	T	A	2: 36,569,018	L140H	probably damaging	Het
Oprm1	T	C	10: 6,830,234	Y299H	probably damaging	Het
Osbpl8	T	C	10: 111,289,790	V777A	possibly damaging	Het
Pcnt	T	C	10: 76,428,014	E372G	probably damaging	Het
Plekhh2	T	C	17: 84,617,999	V1408A	probably benign	Het
Sbk2	T	C	7: 4,957,628	Y181C	probably damaging	Het
Sf1	G	A	19: 6,368,440		probably null	Het
Slc26a9	A	G	1: 131,767,849	E765G	possibly damaging	Het
Stab2	A	G	10: 86,922,185	L1073P	probably damaging	Het
Sypl2	A	G	3: 108,217,676	I123T	possibly damaging	Het
Taar3	A	G	10: 23,949,859	D101G	possibly damaging	Het
Thsd4	T	C	9: 59,997,222	R204G	probably benign	Het
Traf3ip3	A	G	1: 193,181,320	V414A	probably damaging	Het
Trim14	T	A	4: 46,523,709	T110S	probably benign	Het
Trim65	G	A	11: 116,126,479	Q386*	probably null	Het
Ttn	G	A	2: 76,917,770	Q4312*	probably null	Het
Vmn1r58	C	A	7: 5,410,655	W192L	probably damaging	Het
Washc5	C	A	15: 59,339,862	C969F	probably damaging	Het
Zdhhc14	A	G	17: 5,726,856	K296R	probably benign	Het
Zfp281	T	A	1: 136,626,121	I279N	probably damaging	Het
Zfp9	G	T	6: 118,464,769	P311T	probably damaging	Het

Other mutations in Ubtfl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01886:Ubtfl1	APN	9	18409721	missense	possibly damaging	0.93
IGL02028:Ubtfl1	APN	9	18409553	missense	possibly damaging	0.83
R0112:Ubtfl1	UTSW	9	18409787	missense	probably benign	0.24
R0600:Ubtfl1	UTSW	9	18409364	missense	probably damaging	1.00
R1450:Ubtfl1	UTSW	9	18409913	missense	possibly damaging	0.54
R1511:Ubtfl1	UTSW	9	18410193	missense	probably benign	0.00
R2007:Ubtfl1	UTSW	9	18409251	missense	possibly damaging	0.93
R3611:Ubtfl1	UTSW	9	18409365	missense	probably damaging	1.00
R3836:Ubtfl1	UTSW	9	18409237	missense	possibly damaging	0.67
R4577:Ubtfl1	UTSW	9	18409493	missense	probably damaging	1.00
R5057:Ubtfl1	UTSW	9	18409191	missense	possibly damaging	0.83
R5224:Ubtfl1	UTSW	9	18410030	missense	probably benign	0.34
R5284:Ubtfl1	UTSW	9	18409445	nonsense	probably null
R5965:Ubtfl1	UTSW	9	18409542	missense	probably benign	0.04
R6261:Ubtfl1	UTSW	9	18409296	missense	possibly damaging	0.65
R6449:Ubtfl1	UTSW	9	18409629	missense	possibly damaging	0.88
R6951:Ubtfl1	UTSW	9	18409577	missense	probably benign	0.03
R7130:Ubtfl1	UTSW	9	18409847	missense	probably damaging	1.00
R7133:Ubtfl1	UTSW	9	18409635	missense	probably damaging	1.00
R7664:Ubtfl1	UTSW	9	18409486	missense	possibly damaging	0.66
R7718:Ubtfl1	UTSW	9	18409231	missense	possibly damaging	0.77
R8171:Ubtfl1	UTSW	9	18409227	missense	probably benign	0.09
Z1177:Ubtfl1	UTSW	9	18409667	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTACGAAGTCACAAGGAG -3'
(R):5'- AAACTTGGAGCTTCTGCCTCC -3'

Sequencing Primer
(F):5'- GTCTCTTGTAAAAACAGAATCTCCC -3'
(R):5'- GCCTCCAGACATGCTCATG -3'

Posted On

2015-05-15