Incidental Mutation 'R4088:Nfasc'
ID317447
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
MMRRC Submission 040981-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4088 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132595591 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 887 (V887E)
Ref Sequence ENSEMBL: ENSMUSP00000092148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043189
AA Change: V973E

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: V973E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094569
AA Change: V887E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: V887E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163770
AA Change: V990E

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: V990E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186389
AA Change: V974E
Predicted Effect probably damaging
Transcript: ENSMUST00000187861
AA Change: V994E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: V994E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188307
SMART Domains Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 1.8e-2 SMART
IG 141 228 1e-9 SMART
IGc2 253 317 6.4e-20 SMART
IGc2 343 409 7e-11 SMART
IGc2 437 502 9.7e-13 SMART
IGc2 528 593 1.1e-7 SMART
FN3 622 705 1e-13 SMART
FN3 722 804 1.4e-8 SMART
FN3 820 890 3.8e-1 SMART
Meta Mutation Damage Score 0.1684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T C 1: 181,227,709 noncoding transcript Het
Alox12b G T 11: 69,158,385 V87L probably benign Het
Arsk T G 13: 76,098,414 N32T probably benign Het
Baz1b T A 5: 135,216,940 N414K probably damaging Het
Cacna1e A T 1: 154,412,183 probably null Het
Cdc73 A G 1: 143,608,514 probably benign Het
Cdhr2 A G 13: 54,717,888 D233G probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Cyp2b9 T C 7: 26,173,456 L8P probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dnajc6 T A 4: 101,639,396 V920E probably damaging Het
Eef2kmt A T 16: 5,253,035 I50N probably damaging Het
Esyt3 T C 9: 99,324,237 M40V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr26 G T 7: 131,967,076 C50F probably benign Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Hsdl2 T A 4: 59,610,636 L211Q unknown Het
Khdrbs2 A G 1: 32,333,524 E93G probably damaging Het
Kif13b T C 14: 64,767,455 probably null Het
Kif15 T A 9: 122,986,189 L423I probably benign Het
Kmt2c A G 5: 25,287,713 V834A probably benign Het
Lama3 T A 18: 12,504,308 Y28* probably null Het
Map4k2 A T 19: 6,353,156 H763L probably damaging Het
Mkl2 T C 16: 13,384,200 F120S probably damaging Het
Ndufs3 C T 2: 90,898,345 probably benign Het
Npsr1 G A 9: 24,313,769 E358K possibly damaging Het
Nrcam T C 12: 44,572,202 L828P possibly damaging Het
Olfr344 T A 2: 36,569,018 L140H probably damaging Het
Oprm1 T C 10: 6,830,234 Y299H probably damaging Het
Osbpl8 T C 10: 111,289,790 V777A possibly damaging Het
Pcnt T C 10: 76,428,014 E372G probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Sbk2 T C 7: 4,957,628 Y181C probably damaging Het
Sf1 G A 19: 6,368,440 probably null Het
Slc26a9 A G 1: 131,767,849 E765G possibly damaging Het
Stab2 A G 10: 86,922,185 L1073P probably damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar3 A G 10: 23,949,859 D101G possibly damaging Het
Thsd4 T C 9: 59,997,222 R204G probably benign Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ttn G A 2: 76,917,770 Q4312* probably null Het
Ubtfl1 T C 9: 18,409,968 V264A probably damaging Het
Vmn1r58 C A 7: 5,410,655 W192L probably damaging Het
Washc5 C A 15: 59,339,862 C969F probably damaging Het
Zdhhc14 A G 17: 5,726,856 K296R probably benign Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp9 G T 6: 118,464,769 P311T probably damaging Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
R7838_nfasc_079 UTSW 1 132605549 missense probably damaging 1.00
Tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 splice site probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4818:Nfasc UTSW 1 132603830 missense possibly damaging 0.87
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
R7682:Nfasc UTSW 1 132573773 missense unknown
R7838:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7871:Nfasc UTSW 1 132600013 missense not run
R7938:Nfasc UTSW 1 132605531 missense probably damaging 1.00
R8083:Nfasc UTSW 1 132596582 missense probably benign 0.00
R8482:Nfasc UTSW 1 132605089 missense probably damaging 1.00
Z1176:Nfasc UTSW 1 132634638 missense probably benign 0.00
Z1177:Nfasc UTSW 1 132631838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCTGTGGCCTCACTTC -3'
(R):5'- GATGCCCGCCTTTAAATCAG -3'

Sequencing Primer
(F):5'- CTTCCTTTCTAGCCGGGAAGG -3'
(R):5'- CGCCTTTAAATCAGGTCTTGAG -3'
Posted On2015-05-15