Incidental Mutation 'R4227:Serpina10'
ID320101
Institutional Source Beutler Lab
Gene Symbol Serpina10
Ensembl Gene ENSMUSG00000061947
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
SynonymsPZI
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103614786-103631444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103628415 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 182 (Y182H)
Ref Sequence ENSEMBL: ENSMUSP00000113644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044231] [ENSMUST00000121625]
Predicted Effect probably damaging
Transcript: ENSMUST00000044231
AA Change: Y182H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048357
Gene: ENSMUSG00000061947
AA Change: Y182H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 445 2.79e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121625
AA Change: Y182H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113644
Gene: ENSMUSG00000061947
AA Change: Y182H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 391 3.12e-53 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large serpin family of proteins, and is also known as serpin PZ-dependent protease inhibitor (ZPI or PZI). This protein is thought to play an important role in the regulation of coagulation. It directly inhibits factor XIa, and also inhibits factor Xa in the presence of calcium, phospholipids, and protein Z (PZ). Deficiencies in this gene lead to an increase in thrombosis. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduced survival rate, enhanced thrombosis after ferric chloride-induced carotid artery injury, and increased mortality from pulmonary thromboembolism following collagen/epinephrine infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Serpina10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Serpina10 APN 12 103616949 missense probably damaging 1.00
IGL02411:Serpina10 APN 12 103616943 missense possibly damaging 0.94
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0526:Serpina10 UTSW 12 103616868 missense probably damaging 1.00
R1387:Serpina10 UTSW 12 103628241 missense probably benign
R1986:Serpina10 UTSW 12 103628255 missense possibly damaging 0.95
R2277:Serpina10 UTSW 12 103626743 missense probably benign 0.13
R5237:Serpina10 UTSW 12 103628816 missense probably benign 0.39
R5506:Serpina10 UTSW 12 103626661 missense probably damaging 1.00
R6144:Serpina10 UTSW 12 103628833 missense probably benign 0.01
R6726:Serpina10 UTSW 12 103628369 missense probably benign 0.40
R6819:Serpina10 UTSW 12 103628360 missense probably benign 0.05
R7351:Serpina10 UTSW 12 103628935 missense probably benign
R7780:Serpina10 UTSW 12 103628547 missense probably benign 0.01
R8052:Serpina10 UTSW 12 103628310 missense probably damaging 0.99
R8094:Serpina10 UTSW 12 103628773 small deletion probably benign
R8213:Serpina10 UTSW 12 103628277 missense probably benign 0.01
R8318:Serpina10 UTSW 12 103616848 missense possibly damaging 0.58
Y4337:Serpina10 UTSW 12 103624476 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTGGGGCAACAGGAGATTC -3'
(R):5'- ACGACGGCAATGTGATCTTC -3'

Sequencing Primer
(F):5'- GCAACAGGAGATTCCAAATACCTTTG -3'
(R):5'- GCCTGTCTGTGGCCATG -3'
Posted On2015-06-12