Mutagenetix > Incidental Mutations

Incidental Mutation 'R0051:Serpina10'

64303

Institutional Source

Beutler Lab

Gene Symbol

Serpina10

Ensembl Gene

ENSMUSG00000061947

Gene Name

serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10

Synonyms

PZI

MMRRC Submission

038345-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R0051 (G1)

Quality Score

165

Status

Validated

Chromosome

Chromosomal Location

103614786-103631444 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 103626897 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113644 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044231] [ENSMUST00000121625]

Predicted Effect

probably benign
Transcript: ENSMUST00000044231

SMART Domains

Protein: ENSMUSP00000048357
Gene: ENSMUSG00000061947

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
SERPIN	88	445	2.79e-105	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121625

SMART Domains

Protein: ENSMUSP00000113644
Gene: ENSMUSG00000061947

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
SERPIN	88	391	3.12e-53	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.1%
20x: 93.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the large serpin family of proteins, and is also known as serpin PZ-dependent protease inhibitor (ZPI or PZI). This protein is thought to play an important role in the regulation of coagulation. It directly inhibits factor XIa, and also inhibits factor Xa in the presence of calcium, phospholipids, and protein Z (PZ). Deficiencies in this gene lead to an increase in thrombosis. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduced survival rate, enhanced thrombosis after ferric chloride-induced carotid artery injury, and increased mortality from pulmonary thromboembolism following collagen/epinephrine infusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,579,101		noncoding transcript	Het
Abr	T	A	11: 76,472,502	Q163L	probably benign	Het
AI314180	A	G	4: 58,832,729	L877S	probably damaging	Het
Ankrd11	C	A	8: 122,889,742	C2457F	probably damaging	Het
Anks3	G	C	16: 4,947,749	T163S	probably benign	Het
Cacna1d	G	A	14: 30,111,095	P908S	probably damaging	Het
Ccdc146	C	A	5: 21,316,904	R374L	possibly damaging	Het
Cdc45	G	T	16: 18,794,774	A348E	probably damaging	Het
Cfap46	A	G	7: 139,676,035	C300R	probably damaging	Het
Coq2	T	C	5: 100,663,685	N146S	probably benign	Het
Dalrd3	T	C	9: 108,572,215	V120A	possibly damaging	Het
Dcp2	T	A	18: 44,405,374		probably benign	Het
Ddx39	A	G	8: 83,720,622	K137R	possibly damaging	Het
Diaph3	A	G	14: 87,037,454		probably null	Het
Dmbt1	G	T	7: 131,119,496	R1668L	possibly damaging	Het
Dnah7a	T	G	1: 53,521,086		probably benign	Het
Dpp7	A	G	2: 25,356,095	Y49H	possibly damaging	Het
Drd5	A	G	5: 38,320,614	S317G	probably benign	Het
Ecsit	C	T	9: 22,076,288	V152I	probably benign	Het
Emc1	T	A	4: 139,375,163	M923K	possibly damaging	Het
Fam102a	G	A	2: 32,558,053	R58Q	possibly damaging	Het
Fcrl6	A	T	1: 172,598,753	L159Q	probably benign	Het
Frrs1	T	C	3: 116,885,297		probably benign	Het
Hspd1	A	G	1: 55,082,046		probably benign	Het
Impg2	T	A	16: 56,258,048	S458T	probably damaging	Het
Klf17	T	C	4: 117,760,392	Y256C	probably damaging	Het
Lnx2	A	G	5: 147,029,353	F319L	probably damaging	Het
Mafg	G	T	11: 120,629,604	R57S	probably damaging	Het
Med13l	T	A	5: 118,742,655	W1271R	probably damaging	Het
Mrgprb1	A	G	7: 48,447,214	S24P	probably benign	Het
Mtrf1l	T	C	10: 5,813,384	E315G	probably damaging	Het
Naip1	T	C	13: 100,411,001	E1239G	probably damaging	Het
Ncaph2	T	C	15: 89,369,664	S320P	probably damaging	Het
Nek11	A	G	9: 105,218,539		probably benign	Het
Nlrp2	A	T	7: 5,322,334		probably benign	Het
Odf3	C	A	7: 140,850,221		probably benign	Het
Rbm26	A	C	14: 105,152,540	V216G	possibly damaging	Het
Rnf115	A	G	3: 96,785,022	D178G	probably damaging	Het
Rtel1	C	T	2: 181,350,656	Q424*	probably null	Het
Rwdd4a	A	G	8: 47,537,365		probably benign	Het
Ryr3	T	C	2: 112,869,075	D890G	probably damaging	Het
Scarb1	C	A	5: 125,281,100		probably null	Het
Slc12a5	T	A	2: 164,986,663	W508R	probably damaging	Het
Slc43a2	T	C	11: 75,562,850	C225R	probably damaging	Het
Slc6a9	T	C	4: 117,864,859	F440L	probably damaging	Het
Stac3	G	A	10: 127,508,148	R305H	probably damaging	Het
Stk32b	A	G	5: 37,459,596		probably benign	Het
Syna	A	T	5: 134,559,543	L184H	probably damaging	Het
Tmprss7	T	C	16: 45,673,939	N401S	probably damaging	Het
Yeats2	T	A	16: 20,193,724	Y557*	probably null	Het
Zcchc11	T	G	4: 108,527,004	S1089R	probably damaging	Het
Zfp352	T	C	4: 90,224,285	S221P	probably damaging	Het
Zfp575	A	G	7: 24,586,087	V43A	probably benign	Het
Zfp775	A	G	6: 48,620,772	T527A	probably benign	Het

Other mutations in Serpina10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02261:Serpina10	APN	12	103616949	missense	probably damaging	1.00
IGL02411:Serpina10	APN	12	103616943	missense	possibly damaging	0.94
R0051:Serpina10	UTSW	12	103626897	intron	probably benign
R0526:Serpina10	UTSW	12	103616868	missense	probably damaging	1.00
R1387:Serpina10	UTSW	12	103628241	missense	probably benign
R1986:Serpina10	UTSW	12	103628255	missense	possibly damaging	0.95
R2277:Serpina10	UTSW	12	103626743	missense	probably benign	0.13
R4227:Serpina10	UTSW	12	103628415	missense	probably damaging	0.99
R5237:Serpina10	UTSW	12	103628816	missense	probably benign	0.39
R5506:Serpina10	UTSW	12	103626661	missense	probably damaging	1.00
R6144:Serpina10	UTSW	12	103628833	missense	probably benign	0.01
R6726:Serpina10	UTSW	12	103628369	missense	probably benign	0.40
R6819:Serpina10	UTSW	12	103628360	missense	probably benign	0.05
R7351:Serpina10	UTSW	12	103628935	missense	probably benign
R7780:Serpina10	UTSW	12	103628547	missense	probably benign	0.01
R8052:Serpina10	UTSW	12	103628310	missense	probably damaging	0.99
R8094:Serpina10	UTSW	12	103628773	small deletion	probably benign
R8213:Serpina10	UTSW	12	103628277	missense	probably benign	0.01
R8318:Serpina10	UTSW	12	103616848	missense	possibly damaging	0.58
R8434:Serpina10	UTSW	12	103628304	missense	probably damaging	1.00
R8818:Serpina10	UTSW	12	103628804	missense	probably benign
Y4337:Serpina10	UTSW	12	103624476	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- ACCTGTCTTCTCCATGAGGACCAC -3'
(R):5'- TCAGGCATTGGAAGCCATCCAC -3'

Sequencing Primer
(F):5'- CACTAGCATGGTGGCATTTC -3'
(R):5'- GCCATCCACCAGGAAATGAG -3'

Posted On

2013-08-06