Incidental Mutation 'R0051:Serpina10'
ID 64303
Institutional Source Beutler Lab
Gene Symbol Serpina10
Ensembl Gene ENSMUSG00000061947
Gene Name serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Synonyms PZI
MMRRC Submission 038345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R0051 (G1)
Quality Score 165
Status Validated
Chromosome 12
Chromosomal Location 103614786-103631444 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 103626897 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044231] [ENSMUST00000121625]
AlphaFold Q8R121
Predicted Effect probably benign
Transcript: ENSMUST00000044231
SMART Domains Protein: ENSMUSP00000048357
Gene: ENSMUSG00000061947

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 445 2.79e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121625
SMART Domains Protein: ENSMUSP00000113644
Gene: ENSMUSG00000061947

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
SERPIN 88 391 3.12e-53 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large serpin family of proteins, and is also known as serpin PZ-dependent protease inhibitor (ZPI or PZI). This protein is thought to play an important role in the regulation of coagulation. It directly inhibits factor XIa, and also inhibits factor Xa in the presence of calcium, phospholipids, and protein Z (PZ). Deficiencies in this gene lead to an increase in thrombosis. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduced survival rate, enhanced thrombosis after ferric chloride-induced carotid artery injury, and increased mortality from pulmonary thromboembolism following collagen/epinephrine infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A G 7: 29,579,101 noncoding transcript Het
Abr T A 11: 76,472,502 Q163L probably benign Het
AI314180 A G 4: 58,832,729 L877S probably damaging Het
Ankrd11 C A 8: 122,889,742 C2457F probably damaging Het
Anks3 G C 16: 4,947,749 T163S probably benign Het
Cacna1d G A 14: 30,111,095 P908S probably damaging Het
Ccdc146 C A 5: 21,316,904 R374L possibly damaging Het
Cdc45 G T 16: 18,794,774 A348E probably damaging Het
Cfap46 A G 7: 139,676,035 C300R probably damaging Het
Coq2 T C 5: 100,663,685 N146S probably benign Het
Dalrd3 T C 9: 108,572,215 V120A possibly damaging Het
Dcp2 T A 18: 44,405,374 probably benign Het
Ddx39 A G 8: 83,720,622 K137R possibly damaging Het
Diaph3 A G 14: 87,037,454 probably null Het
Dmbt1 G T 7: 131,119,496 R1668L possibly damaging Het
Dnah7a T G 1: 53,521,086 probably benign Het
Dpp7 A G 2: 25,356,095 Y49H possibly damaging Het
Drd5 A G 5: 38,320,614 S317G probably benign Het
Ecsit C T 9: 22,076,288 V152I probably benign Het
Emc1 T A 4: 139,375,163 M923K possibly damaging Het
Fam102a G A 2: 32,558,053 R58Q possibly damaging Het
Fcrl6 A T 1: 172,598,753 L159Q probably benign Het
Frrs1 T C 3: 116,885,297 probably benign Het
Hspd1 A G 1: 55,082,046 probably benign Het
Impg2 T A 16: 56,258,048 S458T probably damaging Het
Klf17 T C 4: 117,760,392 Y256C probably damaging Het
Lnx2 A G 5: 147,029,353 F319L probably damaging Het
Mafg G T 11: 120,629,604 R57S probably damaging Het
Med13l T A 5: 118,742,655 W1271R probably damaging Het
Mrgprb1 A G 7: 48,447,214 S24P probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Naip1 T C 13: 100,411,001 E1239G probably damaging Het
Ncaph2 T C 15: 89,369,664 S320P probably damaging Het
Nek11 A G 9: 105,218,539 probably benign Het
Nlrp2 A T 7: 5,322,334 probably benign Het
Odf3 C A 7: 140,850,221 probably benign Het
Rbm26 A C 14: 105,152,540 V216G possibly damaging Het
Rnf115 A G 3: 96,785,022 D178G probably damaging Het
Rtel1 C T 2: 181,350,656 Q424* probably null Het
Rwdd4a A G 8: 47,537,365 probably benign Het
Ryr3 T C 2: 112,869,075 D890G probably damaging Het
Scarb1 C A 5: 125,281,100 probably null Het
Slc12a5 T A 2: 164,986,663 W508R probably damaging Het
Slc43a2 T C 11: 75,562,850 C225R probably damaging Het
Slc6a9 T C 4: 117,864,859 F440L probably damaging Het
Stac3 G A 10: 127,508,148 R305H probably damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Syna A T 5: 134,559,543 L184H probably damaging Het
Tmprss7 T C 16: 45,673,939 N401S probably damaging Het
Yeats2 T A 16: 20,193,724 Y557* probably null Het
Zcchc11 T G 4: 108,527,004 S1089R probably damaging Het
Zfp352 T C 4: 90,224,285 S221P probably damaging Het
Zfp575 A G 7: 24,586,087 V43A probably benign Het
Zfp775 A G 6: 48,620,772 T527A probably benign Het
Other mutations in Serpina10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02261:Serpina10 APN 12 103616949 missense probably damaging 1.00
IGL02411:Serpina10 APN 12 103616943 missense possibly damaging 0.94
R0051:Serpina10 UTSW 12 103626897 intron probably benign
R0526:Serpina10 UTSW 12 103616868 missense probably damaging 1.00
R1387:Serpina10 UTSW 12 103628241 missense probably benign
R1986:Serpina10 UTSW 12 103628255 missense possibly damaging 0.95
R2277:Serpina10 UTSW 12 103626743 missense probably benign 0.13
R4227:Serpina10 UTSW 12 103628415 missense probably damaging 0.99
R5237:Serpina10 UTSW 12 103628816 missense probably benign 0.39
R5506:Serpina10 UTSW 12 103626661 missense probably damaging 1.00
R6144:Serpina10 UTSW 12 103628833 missense probably benign 0.01
R6726:Serpina10 UTSW 12 103628369 missense probably benign 0.40
R6819:Serpina10 UTSW 12 103628360 missense probably benign 0.05
R7351:Serpina10 UTSW 12 103628935 missense probably benign
R7780:Serpina10 UTSW 12 103628547 missense probably benign 0.01
R8052:Serpina10 UTSW 12 103628310 missense probably damaging 0.99
R8094:Serpina10 UTSW 12 103628773 small deletion probably benign
R8213:Serpina10 UTSW 12 103628277 missense probably benign 0.01
R8318:Serpina10 UTSW 12 103616848 missense possibly damaging 0.58
R8434:Serpina10 UTSW 12 103628304 missense probably damaging 1.00
R8818:Serpina10 UTSW 12 103628804 missense probably benign
R9526:Serpina10 UTSW 12 103616958 missense probably damaging 1.00
Y4337:Serpina10 UTSW 12 103624476 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACCTGTCTTCTCCATGAGGACCAC -3'
(R):5'- TCAGGCATTGGAAGCCATCCAC -3'

Sequencing Primer
(F):5'- CACTAGCATGGTGGCATTTC -3'
(R):5'- GCCATCCACCAGGAAATGAG -3'
Posted On 2013-08-06