Mutagenetix > Incidental Mutation

Incidental Mutation 'R4227:Arhgef5'

320081

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

041047-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4227 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43279498 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1180 (A1180V)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: A1180V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: A1180V

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: A448V

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Meta Mutation Damage Score

0.1309

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	C	2: 69,284,776	T609A	probably damaging	Het
Agbl2	T	G	2: 90,801,453	L385R	probably damaging	Het
Arfgef2	A	T	2: 166,867,324	D1107V	probably damaging	Het
B9d1	C	G	11: 61,512,657	R160G	probably damaging	Het
Birc6	T	C	17: 74,619,840		probably null	Het
Capn11	A	G	17: 45,642,466		probably null	Het
Ceacam12	G	T	7: 18,071,753	M288I	probably benign	Het
Cfhr3	T	A	1: 139,608,308		noncoding transcript	Het
Copa	A	G	1: 172,118,115		probably benign	Het
Cypt4	A	G	9: 24,625,492	M93V	probably benign	Het
Fat3	G	A	9: 16,377,693	T178I	probably damaging	Het
Gm15931	A	G	7: 4,274,794		noncoding transcript	Het
Gm9871	A	G	6: 101,796,693		noncoding transcript	Het
Gpsm1	T	C	2: 26,339,626		probably benign	Het
Grhl1	A	G	12: 24,611,851	T510A	probably benign	Het
Kcnn3	A	C	3: 89,521,175	H236P	possibly damaging	Het
Kif21b	T	A	1: 136,154,093		probably null	Het
Lcn3	G	T	2: 25,766,111	M59I	probably benign	Het
Mrps27	C	G	13: 99,411,340	P253A	probably damaging	Het
Mug2	A	T	6: 122,040,732	D476V	probably benign	Het
Naca	A	T	10: 128,041,661		probably benign	Het
Naip5	A	G	13: 100,212,768	S1351P	probably damaging	Het
Odf2	A	G	2: 29,901,284		probably benign	Het
Olfr1143	T	A	2: 87,802,875	I162N	probably damaging	Het
Olfr1284	A	G	2: 111,379,065	K22E	probably benign	Het
Olfr444	A	G	6: 42,955,714	Y72C	possibly damaging	Het
Olfr598	A	T	7: 103,328,819	H111L	probably damaging	Het
P3h2	G	T	16: 26,105,453	D77E	probably benign	Het
Pcbp2	A	G	15: 102,478,631	M87V	probably benign	Het
Plekhg6	A	G	6: 125,378,805	L12P	probably damaging	Het
Plekhh2	A	G	17: 84,566,795	T503A	probably benign	Het
Pnpla3	C	A	15: 84,179,190	N256K	probably benign	Het
Polh	A	G	17: 46,172,594	S582P	probably benign	Het
Ptprb	T	C	10: 116,302,225	Y345H	possibly damaging	Het
Rasl11b	T	A	5: 74,198,191	I119N	probably damaging	Het
Rnaseh2a	G	A	8: 84,960,073	T149I	possibly damaging	Het
Serpina10	A	G	12: 103,628,415	Y182H	probably damaging	Het
Serpina1d	A	G	12: 103,767,481	V188A	probably benign	Het
Setd1a	C	A	7: 127,796,647		probably benign	Het
Slc17a8	T	C	10: 89,598,713	N184S	probably damaging	Het
Spen	C	T	4: 141,522,147	S110N	unknown	Het
Tas1r1	T	C	4: 152,028,272	I775V	probably damaging	Het
Tktl2	A	G	8: 66,513,699		probably null	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Tmprss6	C	T	15: 78,446,699	V43M	probably damaging	Het
Try5	A	G	6: 41,313,467	Y28H	possibly damaging	Het
Urad	A	T	5: 147,315,290	F117L	probably damaging	Het
Vegfc	A	G	8: 54,159,410	Y156C	probably damaging	Het
Vmn2r45	A	T	7: 8,483,278	V337E	probably damaging	Het
Vmn2r6	A	T	3: 64,537,948	F696L	probably damaging	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het
Zfp131	T	C	13: 119,766,746	D455G	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCCTAAGTTGACTCTGGCATAC -3'
(R):5'- CAGCTGCAATCTCAATGGCTAAG -3'

Sequencing Primer
(F):5'- GGCATACTCAAATACTCCTTGTG -3'
(R):5'- TGCAATCTCAATGGCTAAGCACAG -3'

Posted On

2015-06-12