Incidental Mutation 'R4227:Arhgef5'
ID320081
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene NameRho guanine nucleotide exchange factor (GEF) 5
Synonyms2210412D05Rik
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43265582-43289320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43279498 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1180 (A1180V)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: A1180V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: A1180V

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182752
Predicted Effect unknown
Transcript: ENSMUST00000182924
AA Change: A448V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.1309 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 utr 5 prime probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7930:Arhgef5 UTSW 6 43275135 nonsense probably null
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCTAAGTTGACTCTGGCATAC -3'
(R):5'- CAGCTGCAATCTCAATGGCTAAG -3'

Sequencing Primer
(F):5'- GGCATACTCAAATACTCCTTGTG -3'
(R):5'- TGCAATCTCAATGGCTAAGCACAG -3'
Posted On2015-06-12