Incidental Mutation 'R4227:Vegfc'
ID320091
Institutional Source Beutler Lab
Gene Symbol Vegfc
Ensembl Gene ENSMUSG00000031520
Gene Namevascular endothelial growth factor C
SynonymsVEGF-C
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location54077606-54187096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54159410 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 156 (Y156C)
Ref Sequence ENSEMBL: ENSMUSP00000148210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033919] [ENSMUST00000210831]
Predicted Effect probably damaging
Transcript: ENSMUST00000033919
AA Change: Y156C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033919
Gene: ENSMUSG00000031520
AA Change: Y156C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDGF 125 209 5.07e-48 SMART
Pfam:CXCXC 279 291 1.6e-7 PFAM
Pfam:CXCXC 327 339 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209703
Predicted Effect probably damaging
Transcript: ENSMUST00000210831
AA Change: Y156C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4568 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family. The encoded protein promotes angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. The proprotein is further cleaved into a fully processed form that can bind and activate VEGFR-2 and VEGFR-3 receptors. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutation of this gene affects the development of the lymphatic system. Homozygous inactivation is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Vegfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00658:Vegfc APN 8 54156948 splice site probably benign
IGL02120:Vegfc APN 8 54181401 missense possibly damaging 0.96
IGL03344:Vegfc APN 8 54157151 missense possibly damaging 0.64
R0620:Vegfc UTSW 8 54157139 missense probably benign 0.01
R1167:Vegfc UTSW 8 54186043 missense probably benign 0.06
R1826:Vegfc UTSW 8 54181312 missense possibly damaging 0.88
R4151:Vegfc UTSW 8 54077789 missense unknown
R4226:Vegfc UTSW 8 54159410 missense probably damaging 1.00
R4414:Vegfc UTSW 8 54181095 missense probably benign 0.02
R5963:Vegfc UTSW 8 54181284 missense probably benign
R6241:Vegfc UTSW 8 54181254 missense probably benign 0.00
R6368:Vegfc UTSW 8 54181230 missense probably damaging 1.00
R6728:Vegfc UTSW 8 54186022 missense probably damaging 0.99
R7044:Vegfc UTSW 8 54157045 missense possibly damaging 0.89
R7776:Vegfc UTSW 8 54077800 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTTAGGATCCTAGCCATTGTTTC -3'
(R):5'- GGCTTGAATTAAGTCACTTCAGTG -3'

Sequencing Primer
(F):5'- ACAAATGCTGTAGGCTCTGC -3'
(R):5'- TTCAGTGAGACCAATCCTCTAAGTC -3'
Posted On2015-06-12