Incidental Mutation 'R4163:Zc3h12c'
ID321614
Institutional Source Beutler Lab
Gene Symbol Zc3h12c
Ensembl Gene ENSMUSG00000035164
Gene Namezinc finger CCCH type containing 12C
SynonymsC230027N18Rik
MMRRC Submission 041006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location52111344-52168572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52115699 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 788 (Y788N)
Ref Sequence ENSEMBL: ENSMUSP00000150821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165519] [ENSMUST00000213645]
Predicted Effect probably damaging
Transcript: ENSMUST00000165519
AA Change: Y807N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127603
Gene: ENSMUSG00000035164
AA Change: Y807N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 53 65 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
Pfam:RNase_Zc3h12a 264 420 1.6e-67 PFAM
low complexity region 644 659 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184156
Predicted Effect probably damaging
Transcript: ENSMUST00000213645
AA Change: Y788N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2817 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Atp13a4 A T 16: 29,541,250 N19K possibly damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Dock1 A G 7: 134,744,322 R198G possibly damaging Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fcgr2b T C 1: 170,963,447 D259G possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Kcna4 G C 2: 107,295,806 W295S probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Pcdh20 C T 14: 88,468,179 D562N probably damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Slfn3 A T 11: 83,212,770 I156F probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Trim72 T C 7: 128,007,908 V203A probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Zc3h12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zc3h12c APN 9 52116665 missense probably damaging 1.00
IGL01288:Zc3h12c APN 9 52117651 splice site probably benign
IGL01993:Zc3h12c APN 9 52116311 missense probably damaging 1.00
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0131:Zc3h12c UTSW 9 52126623 missense possibly damaging 0.87
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R1762:Zc3h12c UTSW 9 52115781 missense probably benign 0.17
R2101:Zc3h12c UTSW 9 52116421 missense probably benign 0.01
R3052:Zc3h12c UTSW 9 52144056 missense possibly damaging 0.94
R3689:Zc3h12c UTSW 9 52115956 missense probably benign 0.00
R4230:Zc3h12c UTSW 9 52144428 critical splice acceptor site probably null
R4803:Zc3h12c UTSW 9 52116553 missense probably damaging 1.00
R5008:Zc3h12c UTSW 9 52116700 missense probably benign 0.00
R5153:Zc3h12c UTSW 9 52126647 missense probably damaging 1.00
R5682:Zc3h12c UTSW 9 52126576 missense probably damaging 1.00
R5843:Zc3h12c UTSW 9 52116682 missense probably benign 0.01
R6613:Zc3h12c UTSW 9 52116112 missense possibly damaging 0.65
R7097:Zc3h12c UTSW 9 52115926 missense possibly damaging 0.77
R7460:Zc3h12c UTSW 9 52144102 missense probably benign 0.13
R7867:Zc3h12c UTSW 9 52143948 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATTCCTTTTCATGACGAGCC -3'
(R):5'- ACCAAGTTCAGCACATTCGAAG -3'

Sequencing Primer
(F):5'- TTTTCATGACGAGCCTCACAAGG -3'
(R):5'- GTTCAGCACATTCGAAGGCACC -3'
Posted On2015-06-12