Incidental Mutation 'R4164:Oas1c'
ID321652
Institutional Source Beutler Lab
Gene Symbol Oas1c
Ensembl Gene ENSMUSG00000001166
Gene Name2'-5' oligoadenylate synthetase 1C
SynonymsOasl5
MMRRC Submission 041638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120800194-120812514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120808139 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 98 (E98G)
Ref Sequence ENSEMBL: ENSMUSP00000112584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086377] [ENSMUST00000117193] [ENSMUST00000125547] [ENSMUST00000183291]
Predicted Effect probably benign
Transcript: ENSMUST00000086377
SMART Domains Protein: ENSMUSP00000083564
Gene: ENSMUSG00000029605

DomainStartEndE-ValueType
Pfam:OAS1_C 158 251 7.1e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117193
AA Change: E98G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112584
Gene: ENSMUSG00000001166
AA Change: E98G

DomainStartEndE-ValueType
Pfam:OAS1_C 168 354 1.4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130045
SMART Domains Protein: ENSMUSP00000122510
Gene: ENSMUSG00000001166

DomainStartEndE-ValueType
Pfam:OAS1_C 89 146 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182725
Predicted Effect probably benign
Transcript: ENSMUST00000183291
SMART Domains Protein: ENSMUSP00000138088
Gene: ENSMUSG00000029605

DomainStartEndE-ValueType
Pfam:OAS1_C 158 345 3.4e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201006
Meta Mutation Damage Score 0.2093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Oas1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Oas1c APN 5 120808679 missense probably benign 0.00
IGL01472:Oas1c APN 5 120802921 missense probably damaging 1.00
IGL01931:Oas1c APN 5 120805495 missense probably benign 0.20
IGL02429:Oas1c APN 5 120802068 missense probably benign 0.30
IGL02498:Oas1c APN 5 120805526 missense possibly damaging 0.83
IGL02696:Oas1c APN 5 120805463 missense probably benign 0.44
IGL02957:Oas1c APN 5 120805413 nonsense probably null
sandshrew UTSW 5 120808139 missense probably damaging 0.99
R0562:Oas1c UTSW 5 120805604 splice site probably benign
R1819:Oas1c UTSW 5 120808735 missense possibly damaging 0.89
R1853:Oas1c UTSW 5 120807995 missense probably damaging 1.00
R1937:Oas1c UTSW 5 120802984 missense probably benign 0.00
R2248:Oas1c UTSW 5 120802861 missense possibly damaging 0.48
R2258:Oas1c UTSW 5 120803017 missense probably null 1.00
R2570:Oas1c UTSW 5 120805438 missense probably benign 0.05
R3965:Oas1c UTSW 5 120808718 missense probably damaging 1.00
R5146:Oas1c UTSW 5 120802094 missense probably benign 0.08
R5875:Oas1c UTSW 5 120805562 missense probably damaging 1.00
R5938:Oas1c UTSW 5 120805533 missense probably benign 0.05
R7219:Oas1c UTSW 5 120802892 missense probably damaging 1.00
R7443:Oas1c UTSW 5 120805419 missense probably damaging 1.00
R7451:Oas1c UTSW 5 120802142 missense possibly damaging 0.57
R7578:Oas1c UTSW 5 120802179 missense probably damaging 1.00
R7788:Oas1c UTSW 5 120801042 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGACTTACATAGGACATCATAG -3'
(R):5'- ACATGGGTGAGCTCTCAGTG -3'

Sequencing Primer
(F):5'- CTTACATAGGACATCATAGGCTGGC -3'
(R):5'- AGTGGTGGACTCCTACTCTATTCAG -3'
Posted On2015-06-12