Incidental Mutation 'R4272:Riok3'
ID322243
Institutional Source Beutler Lab
Gene Symbol Riok3
Ensembl Gene ENSMUSG00000024404
Gene NameRIO kinase 3
SynonymsSudd, 1200013N13Rik, E130306C24Rik, D18Ertd331e
MMRRC Submission 041644-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R4272 (G1)
Quality Score217
Status Validated
Chromosome18
Chromosomal Location12128850-12157367 bp(+) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) AGAAGCGG to AG at 12135941 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025270]
Predicted Effect probably benign
Transcript: ENSMUST00000025270
SMART Domains Protein: ENSMUSP00000025270
Gene: ENSMUSG00000024404

DomainStartEndE-ValueType
low complexity region 41 63 N/A INTRINSIC
low complexity region 123 131 N/A INTRINSIC
RIO 222 470 9.88e-141 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified by the similarity of its product to the Aspergillus nidulans SUDD protein. This gene is now recognized as a member of the right open reading frame (RIO) kinase gene family. This gene encodes a serine/threonine kinase that localizes to the cytoplasm and plays a role in the processing of the pre-40 S ribosomal subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 T A 17: 42,710,122 T604S probably damaging Het
Ago3 T A 4: 126,355,091 T556S possibly damaging Het
Arap2 T C 5: 62,670,979 I950V possibly damaging Het
Arl5b A G 2: 15,073,179 E105G probably damaging Het
Capza3 A G 6: 140,042,538 I288V probably benign Het
Chka G A 19: 3,875,737 probably benign Het
Cnpy4 G T 5: 138,192,591 V159F probably damaging Het
Crb1 T C 1: 139,323,311 I301V probably benign Het
Disp1 T A 1: 183,087,644 I1071F possibly damaging Het
Dlec1 C T 9: 119,143,163 A1417V probably damaging Het
Dlgap1 T A 17: 70,766,043 S686T probably benign Het
Dync1li2 A G 8: 104,423,143 S411P probably damaging Het
Efnb2 T A 8: 8,620,698 S301C probably damaging Het
Enpp4 T C 17: 44,101,807 N279D probably benign Het
Exoc3 A G 13: 74,192,644 V347A probably damaging Het
Ezh1 A G 11: 101,194,908 F641S probably damaging Het
Gcgr T A 11: 120,538,424 probably benign Het
Gm4887 G T 7: 104,821,328 noncoding transcript Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Htt G A 5: 34,849,069 V1441I possibly damaging Het
Lmtk2 A G 5: 144,183,226 M1398V probably benign Het
Lrrc15 T C 16: 30,273,855 N222S probably benign Het
Mctp2 A T 7: 72,259,331 V78E possibly damaging Het
Medag A G 5: 149,422,163 Y103C probably damaging Het
Mphosph9 G A 5: 124,304,203 P361S probably damaging Het
Npffr2 G A 5: 89,568,023 V70M probably damaging Het
Obox3-ps8 A C 17: 36,453,017 noncoding transcript Het
Olfr1222 A G 2: 89,125,362 V123A probably damaging Het
Pdgfra G A 5: 75,183,070 V751I probably benign Het
Phykpl T C 11: 51,585,528 L25P probably damaging Het
Rgl1 A T 1: 152,536,289 I443N probably benign Het
Rragd T C 4: 32,996,099 probably null Het
Rtcb A T 10: 85,957,619 M30K probably damaging Het
Rusc2 T A 4: 43,415,533 C280S probably damaging Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Skp2 C A 15: 9,116,860 probably null Het
Slc52a3 T A 2: 152,005,740 I256N possibly damaging Het
Sycp2 A T 2: 178,358,224 D986E probably benign Het
Tas1r1 T C 4: 152,032,157 E340G possibly damaging Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Trhr G A 15: 44,197,224 V47I probably damaging Het
Trpm2 A T 10: 77,933,642 N749K probably damaging Het
Ttc27 T A 17: 74,840,360 W636R probably damaging Het
Ttc30a1 A G 2: 75,980,474 Y422H probably damaging Het
Ttn C A 2: 76,778,347 R17775L probably damaging Het
Vmn2r55 A G 7: 12,668,179 F394S probably benign Het
Zfp52 C A 17: 21,560,197 Y102* probably null Het
Zyx A G 6: 42,350,946 D70G probably damaging Het
Other mutations in Riok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Riok3 APN 18 12148891 missense possibly damaging 0.81
IGL00229:Riok3 APN 18 12137020 missense probably damaging 1.00
IGL00434:Riok3 APN 18 12148847 missense probably damaging 1.00
IGL01348:Riok3 APN 18 12152963 splice site probably benign
IGL01886:Riok3 APN 18 12139385 missense probably damaging 1.00
IGL02553:Riok3 APN 18 12143016 nonsense probably null
IGL02622:Riok3 APN 18 12142960 missense probably benign 0.24
IGL02718:Riok3 APN 18 12152996 nonsense probably null
LCD18:Riok3 UTSW 18 12129982 intron probably benign
R0240:Riok3 UTSW 18 12155227 missense probably benign 0.37
R0359:Riok3 UTSW 18 12148949 missense probably damaging 1.00
R1505:Riok3 UTSW 18 12152878 missense probably benign 0.06
R1519:Riok3 UTSW 18 12137306 missense probably damaging 1.00
R1698:Riok3 UTSW 18 12128929 missense probably benign 0.02
R1710:Riok3 UTSW 18 12142961 missense probably benign 0.24
R1965:Riok3 UTSW 18 12136962 missense probably damaging 0.99
R2351:Riok3 UTSW 18 12149667 nonsense probably null
R3705:Riok3 UTSW 18 12148954 missense probably benign 0.07
R3914:Riok3 UTSW 18 12148822 missense probably benign
R3956:Riok3 UTSW 18 12142974 nonsense probably null
R4273:Riok3 UTSW 18 12135941 small deletion probably benign
R4564:Riok3 UTSW 18 12148879 missense probably damaging 0.99
R4589:Riok3 UTSW 18 12136787 missense probably benign 0.06
R4729:Riok3 UTSW 18 12128927 missense possibly damaging 0.82
R4751:Riok3 UTSW 18 12153983 missense probably benign 0.00
R4938:Riok3 UTSW 18 12155243 missense probably benign 0.06
R4945:Riok3 UTSW 18 12128915 missense probably damaging 0.96
R5449:Riok3 UTSW 18 12155246 missense probably damaging 0.97
R5928:Riok3 UTSW 18 12153018 missense probably benign 0.16
R6220:Riok3 UTSW 18 12149551 missense probably damaging 0.97
R7962:Riok3 UTSW 18 12136719 missense probably benign
R8422:Riok3 UTSW 18 12136812 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTACCCGAAGTGAACAAGTG -3'
(R):5'- GCTATTTGCTCTGTACTGAAAATCAGG -3'

Sequencing Primer
(F):5'- TACCCGAAGTGAACAAGTGAAAATGC -3'
(R):5'- GATGAACTAGGAACAGTGTGCTTC -3'
Posted On2015-06-20