Incidental Mutation 'R4274:Olfr478'
ID324707
Institutional Source Beutler Lab
Gene Symbol Olfr478
Ensembl Gene ENSMUSG00000094426
Gene Nameolfactory receptor 478
SynonymsGA_x6K02T2PBJ9-10361879-10360935, MOR204-13
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108029965-108033989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108031544 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 266 (K266N)
Ref Sequence ENSEMBL: ENSMUSP00000147713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049719] [ENSMUST00000210173]
Predicted Effect probably benign
Transcript: ENSMUST00000049719
AA Change: K266N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058931
Gene: ENSMUSG00000094426
AA Change: K266N

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.1e-54 PFAM
Pfam:7tm_1 44 293 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210173
AA Change: K266N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Ssr1 G A 13: 37,985,290 L225F possibly damaging Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Olfr478
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr478 APN 7 108031680 missense probably damaging 1.00
IGL01457:Olfr478 APN 7 108032121 missense possibly damaging 0.90
IGL03156:Olfr478 APN 7 108032351 utr 5 prime probably benign
IGL03271:Olfr478 APN 7 108031507 missense probably damaging 0.96
IGL03399:Olfr478 APN 7 108031582 missense probably benign 0.02
R0660:Olfr478 UTSW 7 108031615 missense probably damaging 1.00
R0722:Olfr478 UTSW 7 108032334 missense probably benign 0.00
R1468:Olfr478 UTSW 7 108032388 intron probably null
R1468:Olfr478 UTSW 7 108032388 intron probably null
R2172:Olfr478 UTSW 7 108031467 missense probably damaging 1.00
R5164:Olfr478 UTSW 7 108032280 missense possibly damaging 0.47
R5501:Olfr478 UTSW 7 108032153 nonsense probably null
R7586:Olfr478 UTSW 7 108031921 missense probably benign 0.00
R7846:Olfr478 UTSW 7 108031992 missense probably benign 0.21
R7929:Olfr478 UTSW 7 108031992 missense probably benign 0.21
R8005:Olfr478 UTSW 7 108032263 missense possibly damaging 0.54
Z1176:Olfr478 UTSW 7 108031446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGTATGCTCCTACAATGGC -3'
(R):5'- AGTGTCCCTGCAACTGTTCC -3'

Sequencing Primer
(F):5'- TGGCACATCCCACAGAAC -3'
(R):5'- ACAGCTGGATCCATCATTGTTG -3'
Posted On2015-06-24