Incidental Mutation 'R4274:Ssr1'
ID324727
Institutional Source Beutler Lab
Gene Symbol Ssr1
Ensembl Gene ENSMUSG00000021427
Gene Namesignal sequence receptor, alpha
SynonymsTRAPalpha, SSR
MMRRC Submission 041077-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4274 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location37966605-37994217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37985290 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 225 (L225F)
Ref Sequence ENSEMBL: ENSMUSP00000153120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021864] [ENSMUST00000224399] [ENSMUST00000225246] [ENSMUST00000225319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021864
AA Change: L225F

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021864
Gene: ENSMUSG00000021427
AA Change: L225F

DomainStartEndE-ValueType
Pfam:TRAP_alpha 6 285 1.1e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224399
Predicted Effect possibly damaging
Transcript: ENSMUST00000225246
AA Change: L225F

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225319
AA Change: L225F

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2273 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality, subcutaneous edema, and cardiac defects, including absence of septation of the proximal part of the outflow tract, double outlet right ventricle, persistent truncus arteriosis, and abnormal development of the endocardial cushion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,104 Y36C probably damaging Het
Abcc4 T C 14: 118,629,622 R228G probably damaging Het
Acap2 A T 16: 31,108,114 S528T probably benign Het
Adamts6 T A 13: 104,314,279 D323E possibly damaging Het
Ano8 G T 8: 71,478,741 probably benign Het
Ano9 T G 7: 141,110,695 Q48P probably benign Het
Atp13a1 T G 8: 69,805,292 L899R probably benign Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Csn1s1 T C 5: 87,680,961 *295R probably null Het
Dhx9 A G 1: 153,468,926 I505T probably damaging Het
Dnajc17 A T 2: 119,186,385 S37T probably benign Het
Dot1l T A 10: 80,783,988 probably null Het
Dph7 A G 2: 24,963,500 N109S possibly damaging Het
Ednra C T 8: 77,720,302 G49D probably benign Het
Fam83g T C 11: 61,701,728 M259T probably damaging Het
Fer1l4 A T 2: 156,020,544 D1736E probably damaging Het
Fetub T C 16: 22,935,679 I212T probably damaging Het
Foxc2 C A 8: 121,117,700 S362R probably benign Het
Gm8444 A G 15: 81,843,533 probably benign Het
Gpank1 G A 17: 35,124,269 E242K probably benign Het
Hps4 G A 5: 112,375,030 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ighv1-20 A T 12: 114,724,199 W3R probably damaging Het
Kcnq1 T C 7: 143,184,442 I209T probably damaging Het
Me3 A T 7: 89,806,726 E262V probably damaging Het
Mei1 G A 15: 82,124,863 R1233Q possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgprx3-ps T C 7: 47,309,826 noncoding transcript Het
Olfr1281 A T 2: 111,328,815 Y132F probably damaging Het
Olfr160 A T 9: 37,712,068 D70E probably damaging Het
Olfr478 C A 7: 108,031,544 K266N probably benign Het
Ostm1 T C 10: 42,698,234 F153L probably damaging Het
Pkd1l3 C T 8: 109,624,119 T532I possibly damaging Het
Prpf40a G A 2: 53,146,172 H624Y probably damaging Het
Rtn2 T C 7: 19,287,324 S210P probably benign Het
Siglec1 T C 2: 131,085,814 Q24R probably benign Het
Smurf1 T C 5: 144,896,775 probably benign Het
Tlr6 A G 5: 64,953,638 I642T probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Tnrc18 T C 5: 142,743,650 K1674R unknown Het
Tns1 T A 1: 73,928,098 Y1115F probably damaging Het
Trim56 T A 5: 137,113,687 E325V probably damaging Het
Ttn T C 2: 76,775,974 T18164A possibly damaging Het
Ugt2a3 A T 5: 87,327,689 D361E probably damaging Het
Vmn2r125 T C 4: 156,350,087 I56T probably benign Het
Xkr5 T A 8: 18,934,167 H453L probably benign Het
Zcchc7 C T 4: 44,931,335 H496Y possibly damaging Het
Zfp82 C T 7: 30,056,367 R430H probably damaging Het
Zscan22 T C 7: 12,906,324 V6A probably benign Het
Other mutations in Ssr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Ssr1 APN 13 37983431 missense probably damaging 1.00
IGL02189:Ssr1 APN 13 37987516 critical splice donor site probably null
R1102:Ssr1 UTSW 13 37987615 missense probably benign 0.29
R1625:Ssr1 UTSW 13 37989503 critical splice donor site probably null
R2022:Ssr1 UTSW 13 37989549 missense probably damaging 0.96
R2055:Ssr1 UTSW 13 37987785 splice site probably benign
R6006:Ssr1 UTSW 13 37985996 frame shift probably null
R6659:Ssr1 UTSW 13 37987690 missense probably damaging 0.98
R6920:Ssr1 UTSW 13 37986022 missense probably damaging 1.00
R7034:Ssr1 UTSW 13 37994025 missense probably null
R7036:Ssr1 UTSW 13 37994025 missense probably null
Predicted Primers PCR Primer
(F):5'- GAGAGCAATCAGTACACTAACTGG -3'
(R):5'- GGAAATTTGTAAAGCTTGTAGGCTG -3'

Sequencing Primer
(F):5'- GCAATCAGTACACTAACTGGATATG -3'
(R):5'- AGGCTGGAATTATTTAACATGGTG -3'
Posted On2015-06-24