Incidental Mutation 'R4376:March11'
ID325115
Institutional Source Beutler Lab
Gene Symbol March11
Ensembl Gene ENSMUSG00000022269
Gene Namemembrane-associated ring finger (C3HC4) 11
Synonyms
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R4376 (G1)
Quality Score152
Status Not validated
Chromosome15
Chromosomal Location26309048-26409576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26309446 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 62 (E62G)
Ref Sequence ENSEMBL: ENSMUSP00000120622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126304] [ENSMUST00000140840] [ENSMUST00000152841]
Predicted Effect probably benign
Transcript: ENSMUST00000126304
AA Change: E62G

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000140840
AA Change: E62G

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118729
Gene: ENSMUSG00000022269
AA Change: E62G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
RINGv 167 214 4.81e-16 SMART
transmembrane domain 244 266 N/A INTRINSIC
Blast:AAA 269 296 6e-7 BLAST
low complexity region 329 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152841
AA Change: E62G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120622
Gene: ENSMUSG00000022269
AA Change: E62G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
RINGv 167 214 4.81e-16 SMART
Meta Mutation Damage Score 0.1361 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH11 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). These enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their intracellular transport. March11 appears to have a role in ubiquitin-mediated protein sorting in the trans-Golgi network (TGN)-multivesicular body (MVB) transport pathway (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in March11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:March11 APN 15 26409199 missense possibly damaging 0.93
IGL03079:March11 APN 15 26311058 missense probably damaging 1.00
R0625:March11 UTSW 15 26311043 missense probably damaging 0.99
R1055:March11 UTSW 15 26309662 missense probably damaging 0.99
R1116:March11 UTSW 15 26409295 missense probably damaging 1.00
R1851:March11 UTSW 15 26387830 missense probably damaging 1.00
R3862:March11 UTSW 15 26387866 missense probably damaging 1.00
R3863:March11 UTSW 15 26387866 missense probably damaging 1.00
R3864:March11 UTSW 15 26387866 missense probably damaging 1.00
R4373:March11 UTSW 15 26309446 missense probably damaging 0.96
R4375:March11 UTSW 15 26309446 missense probably damaging 0.96
R4580:March11 UTSW 15 26311103 missense probably damaging 1.00
R6284:March11 UTSW 15 26409346 missense probably benign 0.36
R6710:March11 UTSW 15 26387863 missense probably damaging 1.00
R7490:March11 UTSW 15 26311101 missense possibly damaging 0.88
R7748:March11 UTSW 15 26387830 missense probably damaging 0.98
R7794:March11 UTSW 15 26409198 missense probably benign 0.09
R7937:March11 UTSW 15 26409237 missense probably damaging 0.99
R7942:March11 UTSW 15 26409419 makesense probably null
X0063:March11 UTSW 15 26387893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAGTGCTTGTTCCCAG -3'
(R):5'- ACATACGGAGCGTGTTTCGG -3'

Sequencing Primer
(F):5'- TCCACCATGAGCGACGAG -3'
(R):5'- CTGGTCTCCGGTGCCTC -3'
Posted On2015-07-06