Incidental Mutation 'R4376:Olfr275'
ID325094
Institutional Source Beutler Lab
Gene Symbol Olfr275
Ensembl Gene ENSMUSG00000089717
Gene Nameolfactory receptor 275
SynonymsGA_x6K02T2N78B-7168533-7167574, MOR262-2
MMRRC Submission 041120-MU
Accession Numbers

Ncbi RefSeq: NM_146858.2; MGI: 3030109

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location52814604-52828269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52826195 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 266 (N266I)
Ref Sequence ENSEMBL: ENSMUSP00000092700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095085]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095085
AA Change: N266I

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092700
Gene: ENSMUSG00000089717
AA Change: N266I

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 9.8e-54 PFAM
Pfam:7tm_1 41 290 6.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219705
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Olfr275
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Olfr275 APN 4 52825727 missense probably damaging 1.00
IGL01758:Olfr275 APN 4 52825468 nonsense probably null
IGL01925:Olfr275 APN 4 52825910 missense probably benign 0.00
IGL02525:Olfr275 APN 4 52825616 missense probably damaging 1.00
IGL02536:Olfr275 APN 4 52825817 missense possibly damaging 0.95
IGL02829:Olfr275 APN 4 52826027 missense probably damaging 0.98
R0068:Olfr275 UTSW 4 52825503 nonsense probably null
R0068:Olfr275 UTSW 4 52825503 nonsense probably null
R0190:Olfr275 UTSW 4 52825613 missense probably damaging 0.97
R4617:Olfr275 UTSW 4 52825399 start codon destroyed probably benign 0.35
R4658:Olfr275 UTSW 4 52826240 missense probably damaging 0.99
R4828:Olfr275 UTSW 4 52826138 missense probably damaging 1.00
R4850:Olfr275 UTSW 4 52825450 missense possibly damaging 0.94
R6194:Olfr275 UTSW 4 52825779 nonsense probably null
R6401:Olfr275 UTSW 4 52826242 missense probably damaging 1.00
R6842:Olfr275 UTSW 4 52825576 missense probably damaging 1.00
R7033:Olfr275 UTSW 4 52826089 missense probably benign
R7998:Olfr275 UTSW 4 52825970 missense possibly damaging 0.89
R8101:Olfr275 UTSW 4 52825849 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCAATGTTGCTCATTTGTGTC -3'
(R):5'- TCATGGTTATGTCACTGCTAGACAG -3'

Sequencing Primer
(F):5'- AATGTTGCTCATTTGTGTCTCCTATG -3'
(R):5'- AGACAGTGAGATCATTTAGTAGGTC -3'
Posted On2015-07-06