Incidental Mutation 'R4387:Shoc1'
ID 326258
Institutional Source Beutler Lab
Gene Symbol Shoc1
Ensembl Gene ENSMUSG00000038598
Gene Name shortage in chiasmata 1
Synonyms Mzip2, Gm426, AI481877, LOC242489
MMRRC Submission 041681-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R4387 (G1)
Quality Score 208
Status Not validated
Chromosome 4
Chromosomal Location 59043753-59138983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59060915 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 953 (C953S)
Ref Sequence ENSEMBL: ENSMUSP00000103171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107547]
AlphaFold A2ALV5
Predicted Effect possibly damaging
Transcript: ENSMUST00000107547
AA Change: C953S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: C953S

DomainStartEndE-ValueType
low complexity region 246 264 N/A INTRINSIC
low complexity region 543 560 N/A INTRINSIC
low complexity region 908 917 N/A INTRINSIC
low complexity region 1189 1201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,464,693 (GRCm39) probably null Het
Adprm C T 11: 66,929,019 (GRCm39) R324K probably benign Het
Brd10 A G 19: 29,782,715 (GRCm39) probably benign Het
Calcr T A 6: 3,707,581 (GRCm39) N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cd209b A G 8: 3,975,960 (GRCm39) L67P probably damaging Het
Cp T C 3: 20,031,366 (GRCm39) V601A probably damaging Het
Cyp2a5 A G 7: 26,540,479 (GRCm39) D364G probably damaging Het
Eno4 T A 19: 58,941,640 (GRCm39) V187D probably benign Het
Fbxl7 C A 15: 26,543,345 (GRCm39) S434I probably damaging Het
Fbxw24 A T 9: 109,439,053 (GRCm39) L174Q probably damaging Het
Fryl T A 5: 73,243,903 (GRCm39) R91S possibly damaging Het
Gabrd A G 4: 155,473,389 (GRCm39) probably null Het
Gtpbp2 A G 17: 46,477,284 (GRCm39) D383G probably benign Het
Igf1r A G 7: 67,819,757 (GRCm39) I356V probably benign Het
Kcnc1 C A 7: 46,047,126 (GRCm39) R9S possibly damaging Het
Lipi T A 16: 75,370,843 (GRCm39) I125F probably damaging Het
Meig1 T C 2: 3,410,278 (GRCm39) E74G probably damaging Het
Mgat4d A T 8: 84,098,335 (GRCm39) Q366L probably damaging Het
Mrpl1 A G 5: 96,386,778 (GRCm39) N256D possibly damaging Het
Nlrp4e A G 7: 23,000,902 (GRCm39) K66E probably benign Het
Nlrp4e A G 7: 23,020,652 (GRCm39) I380V probably benign Het
Nphp3 A G 9: 103,907,219 (GRCm39) T740A possibly damaging Het
Or5an1c A G 19: 12,218,503 (GRCm39) V174A probably damaging Het
Or8k33 T C 2: 86,384,298 (GRCm39) T57A probably damaging Het
Or8k40 T A 2: 86,584,464 (GRCm39) D206V probably benign Het
Pde5a T C 3: 122,523,001 (GRCm39) I36T probably benign Het
Pign A T 1: 105,449,785 (GRCm39) L914M possibly damaging Het
Ppm1b A G 17: 85,322,847 (GRCm39) D382G probably benign Het
Psd3 T C 8: 68,453,413 (GRCm39) Y282C probably damaging Het
Ptprt A T 2: 161,769,570 (GRCm39) Y432N probably damaging Het
Rbbp6 T C 7: 122,596,534 (GRCm39) probably null Het
Recql4 A G 15: 76,590,158 (GRCm39) S659P probably benign Het
Rpl7a-ps3 G A 15: 36,308,429 (GRCm39) noncoding transcript Het
Slit3 T C 11: 35,574,875 (GRCm39) V1063A probably benign Het
Spdye4a A G 5: 143,211,378 (GRCm39) V62A probably benign Het
Ttc6 G A 12: 57,689,836 (GRCm39) G509S probably benign Het
Ush2a C T 1: 188,175,628 (GRCm39) T1242M probably benign Het
Wwc2 T C 8: 48,284,681 (GRCm39) S1155G unknown Het
Zfp551 A T 7: 12,152,568 (GRCm39) I55N probably damaging Het
Other mutations in Shoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Shoc1 APN 4 59,086,961 (GRCm39) missense probably benign
IGL00574:Shoc1 APN 4 59,094,201 (GRCm39) missense possibly damaging 0.66
IGL01333:Shoc1 APN 4 59,047,870 (GRCm39) missense possibly damaging 0.66
IGL02282:Shoc1 APN 4 59,111,114 (GRCm39) missense unknown
IGL02418:Shoc1 APN 4 59,049,075 (GRCm39) splice site probably benign
IGL02621:Shoc1 APN 4 59,062,668 (GRCm39) missense probably damaging 0.97
IGL03028:Shoc1 APN 4 59,094,274 (GRCm39) missense possibly damaging 0.66
IGL03112:Shoc1 APN 4 59,049,355 (GRCm39) missense probably benign 0.27
IGL03137:Shoc1 APN 4 59,094,162 (GRCm39) missense probably benign 0.27
IGL03220:Shoc1 APN 4 59,082,378 (GRCm39) nonsense probably null
IGL03386:Shoc1 APN 4 59,069,315 (GRCm39) missense possibly damaging 0.66
1mM(1):Shoc1 UTSW 4 59,048,024 (GRCm39) nonsense probably null
R0071:Shoc1 UTSW 4 59,059,643 (GRCm39) missense possibly damaging 0.92
R0071:Shoc1 UTSW 4 59,059,643 (GRCm39) missense possibly damaging 0.92
R0194:Shoc1 UTSW 4 59,066,534 (GRCm39) splice site probably benign
R0366:Shoc1 UTSW 4 59,099,410 (GRCm39) missense probably benign 0.09
R0680:Shoc1 UTSW 4 59,043,967 (GRCm39) missense probably benign 0.00
R1419:Shoc1 UTSW 4 59,064,457 (GRCm39) missense possibly damaging 0.66
R1599:Shoc1 UTSW 4 59,072,349 (GRCm39) missense possibly damaging 0.82
R1699:Shoc1 UTSW 4 59,113,926 (GRCm39) missense unknown
R1799:Shoc1 UTSW 4 59,099,383 (GRCm39) missense possibly damaging 0.92
R1832:Shoc1 UTSW 4 59,066,441 (GRCm39) missense probably benign 0.05
R1870:Shoc1 UTSW 4 59,054,142 (GRCm39) splice site probably benign
R2076:Shoc1 UTSW 4 59,082,410 (GRCm39) missense possibly damaging 0.46
R2170:Shoc1 UTSW 4 59,069,215 (GRCm39) missense possibly damaging 0.92
R2870:Shoc1 UTSW 4 59,093,850 (GRCm39) missense probably damaging 0.97
R2870:Shoc1 UTSW 4 59,093,850 (GRCm39) missense probably damaging 0.97
R2871:Shoc1 UTSW 4 59,093,850 (GRCm39) missense probably damaging 0.97
R2871:Shoc1 UTSW 4 59,093,850 (GRCm39) missense probably damaging 0.97
R2872:Shoc1 UTSW 4 59,093,850 (GRCm39) missense probably damaging 0.97
R2872:Shoc1 UTSW 4 59,093,850 (GRCm39) missense probably damaging 0.97
R2873:Shoc1 UTSW 4 59,093,850 (GRCm39) missense probably damaging 0.97
R3026:Shoc1 UTSW 4 59,062,656 (GRCm39) missense possibly damaging 0.83
R3079:Shoc1 UTSW 4 59,047,848 (GRCm39) missense possibly damaging 0.82
R3853:Shoc1 UTSW 4 59,047,390 (GRCm39) missense possibly damaging 0.66
R3914:Shoc1 UTSW 4 59,094,201 (GRCm39) missense possibly damaging 0.66
R4006:Shoc1 UTSW 4 59,076,500 (GRCm39) missense possibly damaging 0.53
R4364:Shoc1 UTSW 4 59,082,294 (GRCm39) missense possibly damaging 0.92
R4454:Shoc1 UTSW 4 59,092,383 (GRCm39) missense possibly damaging 0.90
R4811:Shoc1 UTSW 4 59,082,404 (GRCm39) missense probably benign 0.19
R4853:Shoc1 UTSW 4 59,072,345 (GRCm39) missense possibly damaging 0.66
R4899:Shoc1 UTSW 4 59,062,640 (GRCm39) missense probably damaging 0.97
R5090:Shoc1 UTSW 4 59,111,108 (GRCm39) missense unknown
R5169:Shoc1 UTSW 4 59,059,618 (GRCm39) missense possibly damaging 0.66
R5297:Shoc1 UTSW 4 59,047,543 (GRCm39) missense probably benign
R5400:Shoc1 UTSW 4 59,082,432 (GRCm39) missense possibly damaging 0.83
R5419:Shoc1 UTSW 4 59,049,017 (GRCm39) missense probably benign 0.04
R5668:Shoc1 UTSW 4 59,047,399 (GRCm39) missense probably benign
R5770:Shoc1 UTSW 4 59,092,466 (GRCm39) missense probably benign 0.00
R5783:Shoc1 UTSW 4 59,076,239 (GRCm39) nonsense probably null
R5929:Shoc1 UTSW 4 59,092,497 (GRCm39) nonsense probably null
R6209:Shoc1 UTSW 4 59,043,869 (GRCm39) makesense probably null
R6230:Shoc1 UTSW 4 59,099,345 (GRCm39) missense probably benign
R6233:Shoc1 UTSW 4 59,076,245 (GRCm39) missense possibly damaging 0.92
R6351:Shoc1 UTSW 4 59,069,317 (GRCm39) missense probably benign 0.00
R6785:Shoc1 UTSW 4 59,049,066 (GRCm39) missense probably benign 0.01
R6884:Shoc1 UTSW 4 59,059,652 (GRCm39) missense possibly damaging 0.83
R7355:Shoc1 UTSW 4 59,076,155 (GRCm39) missense probably benign
R7423:Shoc1 UTSW 4 59,076,264 (GRCm39) missense probably benign 0.27
R7484:Shoc1 UTSW 4 59,062,286 (GRCm39) missense probably damaging 0.97
R7560:Shoc1 UTSW 4 59,076,140 (GRCm39) missense possibly damaging 0.66
R7999:Shoc1 UTSW 4 59,094,162 (GRCm39) missense probably benign 0.27
R8198:Shoc1 UTSW 4 59,065,174 (GRCm39) missense probably benign 0.10
R8979:Shoc1 UTSW 4 59,047,276 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTGGTAAGTTCCTACCTTTGAATG -3'
(R):5'- AGAGGCTTTCCAGGTGAACAG -3'

Sequencing Primer
(F):5'- AAGTTCCTACCTTTGAATGTATTCC -3'
(R):5'- GCTTTCCAGGTGAACAGGTATAG -3'
Posted On 2015-07-06