Incidental Mutation 'R4387:AI481877'
ID 326258
Institutional Source Beutler Lab
Gene Symbol AI481877
Ensembl Gene ENSMUSG00000038598
Gene Name expressed sequence AI481877
Synonyms LOC242489, Gm426
MMRRC Submission 041681-MU
Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R4387 (G1)
Quality Score 208
Status Not validated
Chromosome 4
Chromosomal Location 59043753-59138983 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59060915 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 953 (C953S)
Ref Sequence ENSEMBL: ENSMUSP00000103171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107547]
AlphaFold A2ALV5
Predicted Effect possibly damaging
Transcript: ENSMUST00000107547
AA Change: C953S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: C953S

DomainStartEndE-ValueType
low complexity region 246 264 N/A INTRINSIC
low complexity region 543 560 N/A INTRINSIC
low complexity region 908 917 N/A INTRINSIC
low complexity region 1189 1201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
9930021J03Rik A G 19: 29,805,315 probably benign Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Calcr T A 6: 3,707,581 N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cp T C 3: 19,977,202 V601A probably damaging Het
Cyp2a5 A G 7: 26,841,054 D364G probably damaging Het
Eno4 T A 19: 58,953,208 V187D probably benign Het
Fbxl7 C A 15: 26,543,259 S434I probably damaging Het
Fbxw24 A T 9: 109,609,985 L174Q probably damaging Het
Fryl T A 5: 73,086,560 R91S possibly damaging Het
Gabrd A G 4: 155,388,932 probably null Het
Gtpbp2 A G 17: 46,166,358 D383G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Lipi T A 16: 75,573,955 I125F probably damaging Het
Meig1 T C 2: 3,409,241 E74G probably damaging Het
Mgat4d A T 8: 83,371,706 Q366L probably damaging Het
Mrpl1 A G 5: 96,238,919 N256D possibly damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nphp3 A G 9: 104,030,020 T740A possibly damaging Het
Olfr1080 T C 2: 86,553,954 T57A probably damaging Het
Olfr1090 T A 2: 86,754,120 D206V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pde5a T C 3: 122,729,352 I36T probably benign Het
Pign A T 1: 105,522,060 L914M possibly damaging Het
Ppm1b A G 17: 85,015,419 D382G probably benign Het
Psd3 T C 8: 68,000,761 Y282C probably damaging Het
Ptprt A T 2: 161,927,650 Y432N probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slit3 T C 11: 35,684,048 V1063A probably benign Het
Spdye4a A G 5: 143,225,623 V62A probably benign Het
Ttc6 G A 12: 57,643,050 G509S probably benign Het
Ush2a C T 1: 188,443,431 T1242M probably benign Het
Wwc2 T C 8: 47,831,646 S1155G unknown Het
Zfp551 A T 7: 12,418,641 I55N probably damaging Het
Other mutations in AI481877
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:AI481877 APN 4 59086961 missense probably benign
IGL00574:AI481877 APN 4 59094201 missense possibly damaging 0.66
IGL01333:AI481877 APN 4 59047870 missense possibly damaging 0.66
IGL02282:AI481877 APN 4 59111114 missense unknown
IGL02418:AI481877 APN 4 59049075 splice site probably benign
IGL02621:AI481877 APN 4 59062668 missense probably damaging 0.97
IGL03028:AI481877 APN 4 59094274 missense possibly damaging 0.66
IGL03112:AI481877 APN 4 59049355 missense probably benign 0.27
IGL03137:AI481877 APN 4 59094162 missense probably benign 0.27
IGL03220:AI481877 APN 4 59082378 nonsense probably null
IGL03386:AI481877 APN 4 59069315 missense possibly damaging 0.66
1mM(1):AI481877 UTSW 4 59048024 nonsense probably null
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0194:AI481877 UTSW 4 59066534 splice site probably benign
R0366:AI481877 UTSW 4 59099410 missense probably benign 0.09
R0680:AI481877 UTSW 4 59043967 missense probably benign 0.00
R1419:AI481877 UTSW 4 59064457 missense possibly damaging 0.66
R1599:AI481877 UTSW 4 59072349 missense possibly damaging 0.82
R1699:AI481877 UTSW 4 59113926 missense unknown
R1799:AI481877 UTSW 4 59099383 missense possibly damaging 0.92
R1832:AI481877 UTSW 4 59066441 missense probably benign 0.05
R1870:AI481877 UTSW 4 59054142 splice site probably benign
R2076:AI481877 UTSW 4 59082410 missense possibly damaging 0.46
R2170:AI481877 UTSW 4 59069215 missense possibly damaging 0.92
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2873:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R3026:AI481877 UTSW 4 59062656 missense possibly damaging 0.83
R3079:AI481877 UTSW 4 59047848 missense possibly damaging 0.82
R3853:AI481877 UTSW 4 59047390 missense possibly damaging 0.66
R3914:AI481877 UTSW 4 59094201 missense possibly damaging 0.66
R4006:AI481877 UTSW 4 59076500 missense possibly damaging 0.53
R4364:AI481877 UTSW 4 59082294 missense possibly damaging 0.92
R4454:AI481877 UTSW 4 59092383 missense possibly damaging 0.90
R4811:AI481877 UTSW 4 59082404 missense probably benign 0.19
R4853:AI481877 UTSW 4 59072345 missense possibly damaging 0.66
R4899:AI481877 UTSW 4 59062640 missense probably damaging 0.97
R5090:AI481877 UTSW 4 59111108 missense unknown
R5169:AI481877 UTSW 4 59059618 missense possibly damaging 0.66
R5297:AI481877 UTSW 4 59047543 missense probably benign
R5400:AI481877 UTSW 4 59082432 missense possibly damaging 0.83
R5419:AI481877 UTSW 4 59049017 missense probably benign 0.04
R5668:AI481877 UTSW 4 59047399 missense probably benign
R5770:AI481877 UTSW 4 59092466 missense probably benign 0.00
R5783:AI481877 UTSW 4 59076239 nonsense probably null
R5929:AI481877 UTSW 4 59092497 nonsense probably null
R6209:AI481877 UTSW 4 59043869 makesense probably null
R6230:AI481877 UTSW 4 59099345 missense probably benign
R6233:AI481877 UTSW 4 59076245 missense possibly damaging 0.92
R6351:AI481877 UTSW 4 59069317 missense probably benign 0.00
R6785:AI481877 UTSW 4 59049066 missense probably benign 0.01
R6884:AI481877 UTSW 4 59059652 missense possibly damaging 0.83
R7355:AI481877 UTSW 4 59076155 missense probably benign
R7423:AI481877 UTSW 4 59076264 missense probably benign 0.27
R7484:AI481877 UTSW 4 59062286 missense probably damaging 0.97
R7560:AI481877 UTSW 4 59076140 missense possibly damaging 0.66
R7999:AI481877 UTSW 4 59094162 missense probably benign 0.27
R8198:AI481877 UTSW 4 59065174 missense probably benign 0.10
R8979:AI481877 UTSW 4 59047276 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTGGTAAGTTCCTACCTTTGAATG -3'
(R):5'- AGAGGCTTTCCAGGTGAACAG -3'

Sequencing Primer
(F):5'- AAGTTCCTACCTTTGAATGTATTCC -3'
(R):5'- GCTTTCCAGGTGAACAGGTATAG -3'
Posted On 2015-07-06