Incidental Mutation 'R4387:Nphp3'
ID 326275
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Name nephronophthisis 3 (adolescent)
Synonyms 3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission 041681-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4387 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 104002544-104043818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104030020 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 740 (T740A)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
AlphaFold Q7TNH6
Predicted Effect possibly damaging
Transcript: ENSMUST00000035167
AA Change: T740A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: T740A

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129819
AA Change: T620A
SMART Domains Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: T620A

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192485
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193642
Predicted Effect unknown
Transcript: ENSMUST00000194774
AA Change: T620A
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: T620A

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
9930021J03Rik A G 19: 29,805,315 probably benign Het
Adprm C T 11: 67,038,193 R324K probably benign Het
AI481877 A T 4: 59,060,915 C953S possibly damaging Het
Calcr T A 6: 3,707,581 N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cp T C 3: 19,977,202 V601A probably damaging Het
Cyp2a5 A G 7: 26,841,054 D364G probably damaging Het
Eno4 T A 19: 58,953,208 V187D probably benign Het
Fbxl7 C A 15: 26,543,259 S434I probably damaging Het
Fbxw24 A T 9: 109,609,985 L174Q probably damaging Het
Fryl T A 5: 73,086,560 R91S possibly damaging Het
Gabrd A G 4: 155,388,932 probably null Het
Gtpbp2 A G 17: 46,166,358 D383G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Lipi T A 16: 75,573,955 I125F probably damaging Het
Meig1 T C 2: 3,409,241 E74G probably damaging Het
Mgat4d A T 8: 83,371,706 Q366L probably damaging Het
Mrpl1 A G 5: 96,238,919 N256D possibly damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr1080 T C 2: 86,553,954 T57A probably damaging Het
Olfr1090 T A 2: 86,754,120 D206V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pde5a T C 3: 122,729,352 I36T probably benign Het
Pign A T 1: 105,522,060 L914M possibly damaging Het
Ppm1b A G 17: 85,015,419 D382G probably benign Het
Psd3 T C 8: 68,000,761 Y282C probably damaging Het
Ptprt A T 2: 161,927,650 Y432N probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slit3 T C 11: 35,684,048 V1063A probably benign Het
Spdye4a A G 5: 143,225,623 V62A probably benign Het
Ttc6 G A 12: 57,643,050 G509S probably benign Het
Ush2a C T 1: 188,443,431 T1242M probably benign Het
Wwc2 T C 8: 47,831,646 S1155G unknown Het
Zfp551 A T 7: 12,418,641 I55N probably damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
R8882:Nphp3 UTSW 9 104005594 missense possibly damaging 0.77
R9020:Nphp3 UTSW 9 104031951 missense probably benign 0.00
R9132:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9135:Nphp3 UTSW 9 104032015 missense probably damaging 0.99
R9159:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9204:Nphp3 UTSW 9 104042106 missense probably benign
R9226:Nphp3 UTSW 9 104008129 missense probably benign 0.00
R9229:Nphp3 UTSW 9 104036177 missense probably damaging 1.00
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCTAGAAAACGATCATCTTTCTG -3'
(R):5'- AGACTTGTTGGAAGCACCGG -3'

Sequencing Primer
(F):5'- ATTCCTCACAGCCATTGG -3'
(R):5'- GCTCCAGCCTCTCCCATATG -3'
Posted On 2015-07-06