Incidental Mutation 'R4423:Grik1'
ID327236
Institutional Source Beutler Lab
Gene Symbol Grik1
Ensembl Gene ENSMUSG00000022935
Gene Nameglutamate receptor, ionotropic, kainate 1
SynonymsGlurbeta1, Glur5, D16Ium24e, Glur-5, D16Ium24, GluK5, A830007B11Rik
MMRRC Submission 041143-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87895900-88290265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87923200 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 745 (T745A)
Ref Sequence ENSEMBL: ENSMUSP00000153786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023652] [ENSMUST00000072256] [ENSMUST00000114137] [ENSMUST00000211444] [ENSMUST00000227986] [ENSMUST00000228034] [ENSMUST00000228188]
Predicted Effect probably benign
Transcript: ENSMUST00000023652
AA Change: T730A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000023652
Gene: ENSMUSG00000022935
AA Change: T730A

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 4.7e-69 PFAM
Pfam:Peripla_BP_6 48 347 5.1e-11 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 815 2e-16 BLAST
low complexity region 829 850 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072256
AA Change: T730A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072107
Gene: ENSMUSG00000022935
AA Change: T730A

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 2.6e-72 PFAM
Pfam:Peripla_BP_6 49 347 3.4e-10 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 817 1e-17 BLAST
low complexity region 858 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114137
AA Change: T659A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109773
Gene: ENSMUSG00000022935
AA Change: T659A

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 325 5.4e-63 PFAM
Pfam:Peripla_BP_6 18 315 5.1e-11 PFAM
PBPe 362 730 2.4e-130 SMART
Lig_chan-Glu_bd 372 436 6.34e-31 SMART
Blast:PBPe 738 783 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210700
Predicted Effect probably benign
Transcript: ENSMUST00000211444
AA Change: T730A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227986
AA Change: T745A

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000228034
AA Change: T745A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000228188
AA Change: T745A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to alter the properties of ion flow. Alternative splicing, resulting in transcript variants encoding different isoforms, has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile abnormalities in the electrophysiology of neurons in the brain. Response to chemical pain stimuli is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Grik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Grik1 APN 16 87957600 splice site probably null
IGL01347:Grik1 APN 16 87957593 missense probably benign 0.00
IGL01612:Grik1 APN 16 87946735 missense probably damaging 1.00
IGL02010:Grik1 APN 16 88051508 missense possibly damaging 0.96
IGL02059:Grik1 APN 16 88056049 missense possibly damaging 0.95
IGL02068:Grik1 APN 16 87940651 missense possibly damaging 0.80
IGL02200:Grik1 APN 16 87940565 missense probably damaging 1.00
IGL02206:Grik1 APN 16 87935920 missense probably damaging 1.00
IGL02375:Grik1 APN 16 87946556 missense probably damaging 1.00
IGL02598:Grik1 APN 16 87947984 missense probably damaging 1.00
IGL02686:Grik1 APN 16 88009761 splice site probably null
IGL02890:Grik1 APN 16 87896802 intron probably benign
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0387:Grik1 UTSW 16 88034350 splice site probably benign
R0613:Grik1 UTSW 16 88051333 critical splice donor site probably null
R1087:Grik1 UTSW 16 88006377 missense probably benign 0.00
R1694:Grik1 UTSW 16 87950068 missense probably damaging 0.96
R1905:Grik1 UTSW 16 87896866 nonsense probably null
R1928:Grik1 UTSW 16 88051353 missense probably damaging 0.99
R2157:Grik1 UTSW 16 88056124 missense probably damaging 1.00
R3122:Grik1 UTSW 16 88006473 missense probably damaging 1.00
R3906:Grik1 UTSW 16 88006449 missense probably benign 0.00
R4194:Grik1 UTSW 16 87946728 missense probably benign 0.45
R4343:Grik1 UTSW 16 87896252 missense probably benign 0.00
R4349:Grik1 UTSW 16 87957543 missense probably damaging 1.00
R4416:Grik1 UTSW 16 88051461 missense probably benign 0.00
R4660:Grik1 UTSW 16 87923131 missense probably damaging 1.00
R4804:Grik1 UTSW 16 87957569 missense probably damaging 0.99
R5052:Grik1 UTSW 16 87950098 missense probably benign 0.01
R5126:Grik1 UTSW 16 87947859 missense probably damaging 1.00
R5334:Grik1 UTSW 16 87923194 frame shift probably null
R5335:Grik1 UTSW 16 87923194 frame shift probably null
R5337:Grik1 UTSW 16 87923194 frame shift probably null
R5479:Grik1 UTSW 16 87936026 missense probably damaging 1.00
R6141:Grik1 UTSW 16 87896872 missense probably benign 0.00
R6188:Grik1 UTSW 16 88056071 missense probably benign 0.06
R6335:Grik1 UTSW 16 87947906 missense probably damaging 1.00
R6610:Grik1 UTSW 16 88034312 missense probably damaging 1.00
R6737:Grik1 UTSW 16 88051391 missense probably damaging 1.00
R7275:Grik1 UTSW 16 87912820 missense probably benign 0.06
R7876:Grik1 UTSW 16 87923233 missense
R7959:Grik1 UTSW 16 87923233 missense
R8021:Grik1 UTSW 16 87914222 missense
R8027:Grik1 UTSW 16 87936005 missense
R8096:Grik1 UTSW 16 88006467 missense
RF016:Grik1 UTSW 16 88034186 missense
RF022:Grik1 UTSW 16 87896337 missense
X0018:Grik1 UTSW 16 87946596 missense probably damaging 1.00
Z1177:Grik1 UTSW 16 87946684 missense
Predicted Primers PCR Primer
(F):5'- GAATACTTGTAATCAACATCGCCC -3'
(R):5'- TCCCACGCACAGAGAGTTTC -3'

Sequencing Primer
(F):5'- GCCCCAACTTAGCCTTGG -3'
(R):5'- TTTGACCCACTAGGATGATGAACAGC -3'
Posted On2015-07-07