Incidental Mutation 'R4423:Top2a'
ID327224
Institutional Source Beutler Lab
Gene Symbol Top2a
Ensembl Gene ENSMUSG00000020914
Gene Nametopoisomerase (DNA) II alpha
SynonymsTop-2, DNA Topoisomerase II alpha
MMRRC Submission 041143-MU
Accession Numbers

Ncbi RefSeq: NM_011623.2; MGI:98790

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4423 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98992943-99024189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99001405 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1077 (I1077T)
Ref Sequence ENSEMBL: ENSMUSP00000068896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068031]
Predicted Effect probably benign
Transcript: ENSMUST00000068031
AA Change: I1077T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000068896
Gene: ENSMUSG00000020914
AA Change: I1077T

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TOP2c 22 60 3e-12 BLAST
HATPase_c 75 224 1.81e-2 SMART
TOP2c 79 669 N/A SMART
TOP4c 692 1166 3.58e-234 SMART
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1226 1238 N/A INTRINSIC
low complexity region 1261 1273 N/A INTRINSIC
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1407 1418 N/A INTRINSIC
Pfam:DTHCT 1425 1518 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151997
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Allele List at MGI

All alleles(47) : Targeted(1) Gene trapped(46)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C A 10: 100,605,633 P100Q probably damaging Het
A630010A05Rik A G 16: 14,618,713 Y210C probably benign Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
Asgr2 G A 11: 70,105,385 V218I probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cnot10 T A 9: 114,617,920 I363F probably damaging Het
Coch T A 12: 51,598,149 probably null Het
Dnah1 C T 14: 31,284,761 G2199D probably benign Het
Dock9 A G 14: 121,562,053 probably null Het
Dst T C 1: 34,188,393 I1689T possibly damaging Het
Eif2ak4 T C 2: 118,439,066 F762S probably benign Het
Eif2b5 A G 16: 20,501,719 D195G probably benign Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Fam183b A T 11: 58,796,531 probably null Het
Far1 T A 7: 113,540,598 S84R probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Galnt15 A T 14: 32,058,269 I508F possibly damaging Het
Grik1 T C 16: 87,923,200 T745A probably benign Het
Hira A G 16: 18,956,202 D959G possibly damaging Het
Hsf5 T C 11: 87,631,634 L351P probably damaging Het
Icosl C T 10: 78,071,873 T89I possibly damaging Het
Iws1 T A 18: 32,083,450 N414K probably damaging Het
Kif1b A G 4: 149,214,105 S1035P probably damaging Het
Lcp2 G T 11: 34,078,226 probably benign Het
Map4 C T 9: 110,067,594 T631I probably damaging Het
Nepn T A 10: 52,391,815 I59N probably damaging Het
Nin T A 12: 70,042,978 K1221M probably damaging Het
Nup155 A G 15: 8,121,464 T333A probably damaging Het
Olfr651 T C 7: 104,553,345 V142A probably benign Het
Olfr902 A G 9: 38,449,366 T165A probably benign Het
Olfr961 A G 9: 39,647,116 Y130C probably damaging Het
Plod2 T C 9: 92,601,989 L502S probably benign Het
Pnpt1 A G 11: 29,153,375 probably null Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Prkcq T C 2: 11,256,169 I344T possibly damaging Het
Rbl1 A G 2: 157,168,955 probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sec62 T C 3: 30,814,282 M220T unknown Het
Shprh T G 10: 11,186,518 V1219G possibly damaging Het
Slc25a46 T C 18: 31,609,598 T72A probably benign Het
Slc4a2 G A 5: 24,439,848 W1040* probably null Het
Slc5a1 T C 5: 33,154,674 V470A possibly damaging Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tex47 G T 5: 7,305,364 A182S probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Trpm2 T C 10: 77,935,068 D678G probably benign Het
Ube3a T C 7: 59,276,113 I234T probably benign Het
Vmn2r57 T C 7: 41,426,640 K483E probably damaging Het
Wnk1 T A 6: 119,926,426 S2111C probably damaging Het
Zcchc6 T C 13: 59,822,049 K11E probably damaging Het
Other mutations in Top2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Top2a APN 11 99018821 nonsense probably null
IGL01285:Top2a APN 11 99006159 splice site probably benign
IGL01445:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01451:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01456:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01458:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01481:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01485:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01753:Top2a APN 11 99007274 missense probably damaging 0.97
IGL03029:Top2a APN 11 99018799 missense probably benign 0.03
PIT4581001:Top2a UTSW 11 99002964 missense probably damaging 0.97
PIT4585001:Top2a UTSW 11 99001373 missense probably benign 0.02
R0008:Top2a UTSW 11 99002903 nonsense probably null
R0047:Top2a UTSW 11 98997856 missense probably benign
R0047:Top2a UTSW 11 98997856 missense probably benign
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0116:Top2a UTSW 11 99003590 missense probably benign 0.00
R0245:Top2a UTSW 11 99010096 missense probably benign 0.37
R0276:Top2a UTSW 11 99009907 splice site probably benign
R0288:Top2a UTSW 11 99016423 splice site probably benign
R0335:Top2a UTSW 11 99022955 missense probably benign 0.08
R0422:Top2a UTSW 11 99009853 missense probably damaging 1.00
R0546:Top2a UTSW 11 98999226 missense possibly damaging 0.75
R0558:Top2a UTSW 11 98996839 missense probably benign
R0599:Top2a UTSW 11 99001417 missense probably damaging 0.99
R0727:Top2a UTSW 11 99012148 nonsense probably null
R1565:Top2a UTSW 11 99001054 missense probably damaging 0.99
R1674:Top2a UTSW 11 99009273 missense probably damaging 0.96
R1844:Top2a UTSW 11 99016069 missense probably benign 0.06
R1959:Top2a UTSW 11 98995977 splice site probably null
R2124:Top2a UTSW 11 99004228 missense probably benign 0.00
R2128:Top2a UTSW 11 99009807 missense probably damaging 0.97
R3707:Top2a UTSW 11 98996825 missense probably benign 0.13
R4110:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4112:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4425:Top2a UTSW 11 99001405 missense probably benign 0.00
R4914:Top2a UTSW 11 99002960 missense probably damaging 1.00
R4939:Top2a UTSW 11 99010092 missense probably damaging 1.00
R4944:Top2a UTSW 11 98997850 missense probably benign 0.37
R4971:Top2a UTSW 11 98993841 missense probably damaging 1.00
R5362:Top2a UTSW 11 99018912 missense probably damaging 1.00
R5477:Top2a UTSW 11 99016480 nonsense probably null
R5499:Top2a UTSW 11 99022376 missense probably benign 0.20
R5911:Top2a UTSW 11 99016465 missense possibly damaging 0.92
R7126:Top2a UTSW 11 99014992 missense probably benign 0.09
R7131:Top2a UTSW 11 99004182 missense possibly damaging 0.75
R7174:Top2a UTSW 11 99024096 start gained probably benign
R7329:Top2a UTSW 11 99004246 missense possibly damaging 0.57
R7560:Top2a UTSW 11 99000837 missense probably benign
R7563:Top2a UTSW 11 99016179 missense probably damaging 1.00
R7740:Top2a UTSW 11 98993814 missense probably benign 0.34
R7841:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7894:Top2a UTSW 11 99009605 missense probably damaging 1.00
R7924:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7977:Top2a UTSW 11 99009605 missense probably damaging 1.00
R8122:Top2a UTSW 11 98999167 missense probably benign
U24488:Top2a UTSW 11 99022426 missense probably damaging 1.00
X0025:Top2a UTSW 11 98995941 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GAAGTACAAACATGCAGCTTCC -3'
(R):5'- TCCCTTTTGCAGAGAGGAGG -3'

Sequencing Primer
(F):5'- ACAAACATGCAGCTTCCTTCATTTTC -3'
(R):5'- ACTCACTCTGTAGACCAGGCTG -3'
Posted On2015-07-07