Incidental Mutation 'R4407:Fbln1'
ID327732
Institutional Source Beutler Lab
Gene Symbol Fbln1
Ensembl Gene ENSMUSG00000006369
Gene Namefibulin 1
Synonyms
MMRRC Submission 041689-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R4407 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85205949-85286535 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 85231556 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057410] [ENSMUST00000109432]
Predicted Effect probably null
Transcript: ENSMUST00000057410
SMART Domains Protein: ENSMUSP00000054583
Gene: ENSMUSG00000006369

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF 530 580 1.25e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109432
SMART Domains Protein: ENSMUSP00000105058
Gene: ENSMUSG00000006369

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF_CA 527 571 7.18e-7 SMART
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibulin 1 is a secreted glycoprotein that becomes incorporated into a fibrillar extracellular matrix. Calcium-binding is apparently required to mediate its binding to laminin and nidogen. It mediates platelet adhesion via binding fibrinogen. Four splice variants which differ in the 3' end have been identified. Each variant encodes a different isoform, but no functional distinctions have been identified among the four variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene develop problems with spontaneous bleeding as embryos. Most die within the first two days of life. Those that survive this period develop normally and eventually recover from their early developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830035A12Rik T C 11: 107,532,055 noncoding transcript Het
Bbs10 A G 10: 111,299,859 T278A probably benign Het
BC053393 A G 11: 46,577,380 T94A probably damaging Het
Bcl6b A G 11: 70,226,103 L450P probably damaging Het
Braf T G 6: 39,615,720 K674Q probably damaging Het
Cep112 C T 11: 108,519,201 T481I possibly damaging Het
Cep135 T A 5: 76,624,667 M633K probably benign Het
Cpped1 T C 16: 11,805,421 Y278C probably damaging Het
Depdc5 T A 5: 32,904,534 probably null Het
Dolpp1 C T 2: 30,396,452 A128V possibly damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Fat4 A T 3: 38,958,540 D2328V probably benign Het
Fkbp3 T C 12: 65,070,004 T53A probably damaging Het
Flg2 G T 3: 93,214,869 G1449C unknown Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glyctk A T 9: 106,157,108 probably benign Het
Gm37596 C A 3: 93,692,112 V317L probably benign Het
Gm6430 T C 1: 97,025,572 noncoding transcript Het
Golga1 C A 2: 39,019,641 probably null Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
L3mbtl3 A G 10: 26,313,884 V494A unknown Het
Lama2 AATCAGACAGGAG A 10: 27,212,128 probably benign Het
Lemd3 A T 10: 120,925,430 L907Q possibly damaging Het
Lrp2 A T 2: 69,502,517 V1552D probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mycbp2 A T 14: 103,287,228 D665E probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1178 A T 2: 88,392,083 M279L probably benign Het
Pcdhac2 G T 18: 37,144,446 V160L probably benign Het
Pcnt T C 10: 76,374,870 E2473G possibly damaging Het
Pitpnm2 T A 5: 124,152,615 I3L possibly damaging Het
Prkd3 C A 17: 78,983,558 W176L probably damaging Het
Prpf39 C T 12: 65,056,266 A438V probably damaging Het
Rpgrip1 T A 14: 52,147,399 F655I probably damaging Het
Rrp12 T C 19: 41,892,551 Y147C probably damaging Het
Sec23b A T 2: 144,574,718 N429Y possibly damaging Het
Slc2a10 T A 2: 165,514,764 S115T probably damaging Het
Spg11 A C 2: 122,075,332 D1277E probably benign Het
Sspo A G 6: 48,460,520 D1279G probably damaging Het
St18 T C 1: 6,827,837 I621T probably benign Het
Tbc1d31 T A 15: 57,920,042 D112E possibly damaging Het
Tgm4 A T 9: 123,056,530 D379V probably damaging Het
Thyn1 A T 9: 27,003,597 D15V possibly damaging Het
Tm4sf19 T C 16: 32,407,894 V167A possibly damaging Het
Trim38 A C 13: 23,791,491 Q471P probably benign Het
Trmt1 T A 8: 84,697,755 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp9y T C Y: 1,336,375 I1500V probably benign Het
Vgll4 C T 6: 114,890,612 probably null Het
Vmn1r173 T A 7: 23,703,016 N225K probably damaging Het
Vmn2r22 C T 6: 123,637,954 G226R probably damaging Het
Wnk3 C A X: 151,233,213 P555Q probably benign Het
Yes1 T G 5: 32,640,585 Y83D possibly damaging Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Fbln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Fbln1 APN 15 85227037 missense probably benign 0.00
IGL01017:Fbln1 APN 15 85244189 missense possibly damaging 0.94
IGL02514:Fbln1 APN 15 85244262 nonsense probably null
IGL02693:Fbln1 APN 15 85229574 missense probably benign 0.00
IGL02734:Fbln1 APN 15 85226981 missense probably damaging 1.00
IGL02964:Fbln1 APN 15 85231462 missense probably damaging 1.00
IGL03176:Fbln1 APN 15 85244306 missense possibly damaging 0.69
IGL03274:Fbln1 APN 15 85232678 critical splice donor site probably null
R0090:Fbln1 UTSW 15 85224288 missense possibly damaging 0.94
R0148:Fbln1 UTSW 15 85230826 missense probably damaging 0.97
R0393:Fbln1 UTSW 15 85227076 missense probably damaging 0.99
R0564:Fbln1 UTSW 15 85227107 missense probably benign 0.07
R1276:Fbln1 UTSW 15 85229590 missense probably damaging 1.00
R1592:Fbln1 UTSW 15 85231464 missense probably benign 0.00
R1687:Fbln1 UTSW 15 85227106 missense probably benign 0.02
R2312:Fbln1 UTSW 15 85263348 missense probably benign 0.28
R2363:Fbln1 UTSW 15 85227140 critical splice donor site probably null
R3082:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3083:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3751:Fbln1 UTSW 15 85227078 nonsense probably null
R3752:Fbln1 UTSW 15 85227078 nonsense probably null
R3753:Fbln1 UTSW 15 85227078 nonsense probably null
R4028:Fbln1 UTSW 15 85227116 missense probably benign 0.05
R4406:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4408:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4612:Fbln1 UTSW 15 85238559 missense probably benign 0.00
R4811:Fbln1 UTSW 15 85226966 critical splice acceptor site probably null
R5022:Fbln1 UTSW 15 85237626 missense probably damaging 0.99
R5121:Fbln1 UTSW 15 85237671 missense probably damaging 1.00
R7231:Fbln1 UTSW 15 85206152 missense unknown
R7285:Fbln1 UTSW 15 85237628 missense probably benign 0.01
R7492:Fbln1 UTSW 15 85227061 missense probably damaging 1.00
R7742:Fbln1 UTSW 15 85240716 missense probably damaging 1.00
R8100:Fbln1 UTSW 15 85285156 missense probably damaging 1.00
R8379:Fbln1 UTSW 15 85232572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGTTACTTCTGCATCGC -3'
(R):5'- TCAAATGGGCTAGTGTCACTAAC -3'

Sequencing Primer
(F):5'- CGCCTTAATCTCTCTAGATATCAATG -3'
(R):5'- ATGGGCTAGTGTCACTAACTCAGC -3'
Posted On2015-07-07