Mutagenetix > Incidental Mutation

Incidental Mutation 'R4492:Btbd9'

330807

Institutional Source

Beutler Lab

Gene Symbol

Btbd9

Ensembl Gene

ENSMUSG00000062202

Gene Name

BTB (POZ) domain containing 9

Synonyms

1700023F20Rik

MMRRC Submission

041581-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4492 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30215524-30576287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30527571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 94 (Y94H)

Ref Sequence

ENSEMBL: ENSMUSP00000127300 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]

AlphaFold

Q8C726

Predicted Effect

probably damaging
Transcript: ENSMUST00000079924
AA Change: Y94H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: Y94H

Domain	Start	End	E-Value	Type
BTB	36	137	3.52e-25	SMART
BACK	143	240	1.84e-18	SMART
Pfam:F5_F8_type_C	283	405	3.9e-11	PFAM
Pfam:F5_F8_type_C	431	554	6.3e-12	PFAM
low complexity region	585	612	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168787
AA Change: Y94H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: Y94H

Domain	Start	End	E-Value	Type
BTB	36	137	3.52e-25	SMART
BACK	143	240	1.84e-18	SMART
Pfam:F5_F8_type_C	278	405	1.1e-8	PFAM
Pfam:F5_F8_type_C	433	554	1.4e-8	PFAM
low complexity region	585	612	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr6	T	G	10: 89,725,814	I157L	probably benign	Het
Amph	T	C	13: 19,149,758	V663A	possibly damaging	Het
Anapc16	A	G	10: 59,990,902	S50P	possibly damaging	Het
Ank3	T	A	10: 69,808,925	V60D	probably damaging	Het
Chil3	A	G	3: 106,155,701	I191T	probably damaging	Het
Clpb	T	C	7: 101,787,722	L668P	probably damaging	Het
Cyp2d22	G	A	15: 82,374,370	H97Y	probably benign	Het
Dhrs7	A	T	12: 72,653,125	N244K	probably damaging	Het
Dusp4	C	T	8: 34,807,736	T3M	possibly damaging	Het
Edc4	GGATTTTAGCCA	G	8: 105,885,068		probably null	Het
Etl4	G	A	2: 20,806,865	S1621N	possibly damaging	Het
Fam174a	T	C	1: 95,313,976	S54P	probably benign	Het
Fdxacb1	T	C	9: 50,770,247	F7S	probably damaging	Het
Focad	G	A	4: 88,359,905		probably null	Het
Gpr156	T	A	16: 37,992,106	L268H	probably damaging	Het
Gpr17	A	T	18: 31,947,251	I253N	possibly damaging	Het
H2-T23	A	T	17: 36,032,166	N106K	probably damaging	Het
Hspa4	T	C	11: 53,280,469	R303G	probably damaging	Het
Irgm1	G	A	11: 48,866,128		silent	Het
Jph1	A	C	1: 16,997,546	I114S	probably damaging	Het
Kcna1	C	T	6: 126,642,275	D361N	possibly damaging	Het
Kcna4	G	A	2: 107,296,091	R390Q	probably damaging	Het
Lum	C	A	10: 97,568,438	P65H	probably damaging	Het
Mc4r	A	G	18: 66,859,640	L134P	probably benign	Het
Mroh8	A	T	2: 157,258,040	I248N	probably damaging	Het
Nos2	A	G	11: 78,950,095	T677A	probably benign	Het
Nup37	T	A	10: 88,174,929	F257I	possibly damaging	Het
Olfr231	C	T	1: 174,117,204	V271I	probably benign	Het
Olfr273	T	C	4: 52,855,764	I250V	probably benign	Het
Pdzd2	C	T	15: 12,385,637	D1016N	possibly damaging	Het
Pdzd2	A	C	15: 12,419,481	M501R	possibly damaging	Het
Pitx1	T	C	13: 55,828,652	K65E	probably benign	Het
Pla1a	C	T	16: 38,409,610	A247T	probably benign	Het
Prex2	T	A	1: 11,162,263	S851R	probably benign	Het
Prss8	A	G	7: 127,929,807	S26P	probably damaging	Het
Rasef	A	C	4: 73,734,503	L587R	probably damaging	Het
Rock2	T	A	12: 16,977,683	C1334S	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Serpina6	A	G	12: 103,646,887	W385R	probably damaging	Het
Slc12a5	T	C	2: 164,979,343	M249T	probably benign	Het
Srsf9	T	A	5: 115,332,592	I117N	probably damaging	Het
Taf1	G	T	X: 101,543,059	M313I	possibly damaging	Het
Tmem30a	T	C	9: 79,777,285	H95R	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttc21a	T	C	9: 119,941,280	V139A	probably benign	Het
Zfp236	A	T	18: 82,630,000	V1012D	probably damaging	Het
Zfp612	C	A	8: 110,089,297	Q379K	probably damaging	Het
Zfp930	C	T	8: 69,228,246	Q198*	probably null	Het

Other mutations in Btbd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01519:Btbd9	APN	17	30299601	missense	possibly damaging	0.71
IGL01651:Btbd9	APN	17	30220417	missense	unknown
IGL01814:Btbd9	APN	17	30299535	missense	probably benign	0.01
IGL01820:Btbd9	APN	17	30527409	missense	possibly damaging	0.82
IGL02014:Btbd9	APN	17	30517150	missense	probably damaging	0.98
IGL02075:Btbd9	APN	17	30274936	nonsense	probably null
IGL02390:Btbd9	APN	17	30524814	missense	probably benign	0.22
IGL02414:Btbd9	APN	17	30220559	missense	possibly damaging	0.95
IGL02748:Btbd9	APN	17	30334297	missense	possibly damaging	0.81
crumbs	UTSW	17	30299736	splice site	probably null
grain	UTSW	17	30274942	missense	possibly damaging	0.92
R0023:Btbd9	UTSW	17	30530214	missense	probably damaging	0.96
R0023:Btbd9	UTSW	17	30530214	missense	probably damaging	0.96
R0122:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0123:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0134:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0189:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0190:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0226:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0268:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0344:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0427:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0462:Btbd9	UTSW	17	30530217	missense	possibly damaging	0.82
R0645:Btbd9	UTSW	17	30524967	missense	probably damaging	0.96
R0973:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R0973:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R0974:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R1061:Btbd9	UTSW	17	30527435	missense	probably benign	0.00
R1763:Btbd9	UTSW	17	30334297	missense	possibly damaging	0.81
R1781:Btbd9	UTSW	17	30513593	missense	probably damaging	1.00
R1902:Btbd9	UTSW	17	30530228	missense	probably damaging	0.98
R1995:Btbd9	UTSW	17	30274930	missense	possibly damaging	0.93
R2224:Btbd9	UTSW	17	30527346	missense	probably damaging	0.98
R2237:Btbd9	UTSW	17	30334328	missense	probably benign
R3684:Btbd9	UTSW	17	30334307	missense	probably damaging	0.99
R3800:Btbd9	UTSW	17	30513659	missense	possibly damaging	0.89
R4403:Btbd9	UTSW	17	30485932	intron	probably benign
R4654:Btbd9	UTSW	17	30485587	intron	probably benign
R4854:Btbd9	UTSW	17	30524865	missense	probably damaging	0.98
R5710:Btbd9	UTSW	17	30228868	missense	probably benign	0.16
R5963:Btbd9	UTSW	17	30334218	splice site	probably null
R6295:Btbd9	UTSW	17	30299736	splice site	probably null
R6422:Btbd9	UTSW	17	30530256	missense	probably benign
R7023:Btbd9	UTSW	17	30527572	missense	probably benign	0.02
R7826:Btbd9	UTSW	17	30334327	missense	probably benign	0.42
R7922:Btbd9	UTSW	17	30274884	missense	probably benign	0.01
R7962:Btbd9	UTSW	17	30517203	missense	probably damaging	0.99
R8265:Btbd9	UTSW	17	30334304	missense	possibly damaging	0.86
R8786:Btbd9	UTSW	17	30530170	missense	probably damaging	0.97
R9541:Btbd9	UTSW	17	30220464	missense	possibly damaging	0.96
R9591:Btbd9	UTSW	17	30517248	missense	probably damaging	1.00
R9703:Btbd9	UTSW	17	30530226	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TTCTGTCCATGAACATGCAGC -3'
(R):5'- TCTGTCAGTGTTGGTAACCG -3'

Sequencing Primer
(F):5'- CATGCAGCACATACAAGTTAACTTGG -3'
(R):5'- ACCGTTGTTTCATATATTTTGCAGC -3'

Posted On

2015-07-21