Mutagenetix > Incidental Mutation

Incidental Mutation 'R0069:Slfn10-ps'

33114

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

038360-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R0069 (G1)

Quality Score

215

Status

Validated (trace)

Chromosome

Chromosomal Location

82919681-82926992 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 82926368 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215473

Meta Mutation Damage Score

0.4322

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.4%

Validation Efficiency

96% (52/54)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,538,525 (GRCm39)	C632S	probably damaging	Het
Antxr2	T	A	5: 98,096,109 (GRCm39)	M392L	possibly damaging	Het
Cd101	A	G	3: 100,915,533 (GRCm39)	V678A	probably benign	Het
Clec2g	T	C	6: 128,957,274 (GRCm39)		probably null	Het
Clec2g	T	A	6: 128,925,716 (GRCm39)	S42T	probably benign	Het
Creb1	A	G	1: 64,615,367 (GRCm39)	I240V	possibly damaging	Het
D2hgdh	G	T	1: 93,763,009 (GRCm39)	V265L	possibly damaging	Het
Dctn2	A	T	10: 127,113,354 (GRCm39)		probably null	Het
Diablo	A	T	5: 123,656,087 (GRCm39)	S117R	probably damaging	Het
Ebf2	A	T	14: 67,647,499 (GRCm39)	R349S	probably damaging	Het
Fam168a	C	T	7: 100,484,618 (GRCm39)	A252V	probably benign	Het
Fbn2	T	C	18: 58,202,256 (GRCm39)	Y1299C	probably damaging	Het
Gne	A	C	4: 44,060,099 (GRCm39)	V98G	probably damaging	Het
Hk2	A	G	6: 82,713,509 (GRCm39)		probably null	Het
Ifi206	A	T	1: 173,314,413 (GRCm39)	V9D	probably damaging	Het
Ints3	A	G	3: 90,307,954 (GRCm39)		probably benign	Het
Itgal	A	G	7: 126,909,503 (GRCm39)	T56A	probably benign	Het
Lzts3	T	A	2: 130,478,460 (GRCm39)	T213S	probably benign	Het
Map1b	A	G	13: 99,566,356 (GRCm39)	S2122P	unknown	Het
Mei4	C	T	9: 81,907,635 (GRCm39)	Q223*	probably null	Het
Mpzl3	T	C	9: 44,979,550 (GRCm39)	V167A	probably damaging	Het
Myo1d	A	G	11: 80,528,779 (GRCm39)	I681T	probably damaging	Het
Myom2	A	G	8: 15,167,624 (GRCm39)	T1070A	probably benign	Het
Nacc1	T	A	8: 85,403,828 (GRCm39)	I16F	probably damaging	Het
Nfx1	T	C	4: 40,986,688 (GRCm39)		probably benign	Het
Or10ak12	A	T	4: 118,666,887 (GRCm39)	V58D	probably damaging	Het
Or8g33	A	G	9: 39,338,188 (GRCm39)	Y60H	probably damaging	Het
Ostm1	A	C	10: 42,568,952 (GRCm39)	D37A	probably benign	Het
Pde8a	T	C	7: 80,968,871 (GRCm39)		probably benign	Het
Pole2	A	T	12: 69,256,661 (GRCm39)	V288E	probably damaging	Het
Poteg	T	C	8: 27,937,849 (GRCm39)	S2P	probably benign	Het
Ppp2r5c	A	T	12: 110,534,204 (GRCm39)	M356L	probably benign	Het
Prkdc	G	A	16: 15,544,368 (GRCm39)	S1786N	probably benign	Het
Prox1	A	G	1: 189,893,116 (GRCm39)	V443A	possibly damaging	Het
Prpf6	T	A	2: 181,257,756 (GRCm39)		probably null	Het
Ptger1	A	T	8: 84,394,948 (GRCm39)	T142S	possibly damaging	Het
Rad54l2	C	A	9: 106,587,564 (GRCm39)	V734L	possibly damaging	Het
Rnpepl1	T	A	1: 92,846,620 (GRCm39)	N507K	possibly damaging	Het
Slc38a10	A	T	11: 119,997,328 (GRCm39)	V722E	probably damaging	Het
Slitrk6	A	T	14: 110,987,364 (GRCm39)	L781H	probably damaging	Het
Sult1e1	A	T	5: 87,727,756 (GRCm39)	H175Q	probably damaging	Het
Ube2e3	C	A	2: 78,750,293 (GRCm39)		probably benign	Het
Vmn1r208	A	T	13: 22,956,595 (GRCm39)	W301R	probably benign	Het
Vps13d	A	G	4: 144,789,133 (GRCm39)	I746T	probably benign	Het
Xpnpep3	T	C	15: 81,314,999 (GRCm39)	V233A	probably benign	Het
Zfp329	A	T	7: 12,544,859 (GRCm39)	S222T	probably damaging	Het
Zswim6	T	C	13: 107,875,098 (GRCm39)		noncoding transcript	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	82,926,085 (GRCm39)	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	82,926,353 (GRCm39)	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	82,926,322 (GRCm39)	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	82,926,761 (GRCm39)	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	82,919,938 (GRCm39)	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	82,923,016 (GRCm39)	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	82,919,890 (GRCm39)	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	82,923,117 (GRCm39)	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	82,921,090 (GRCm39)	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	82,920,971 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0164:Slfn10-ps	UTSW	11	82,926,128 (GRCm39)	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	82,926,600 (GRCm39)	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	82,920,360 (GRCm39)	unclassified	noncoding transcript
R0597:Slfn10-ps	UTSW	11	82,926,479 (GRCm39)	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	82,926,388 (GRCm39)	unclassified	noncoding transcript
R0904:Slfn10-ps	UTSW	11	82,926,235 (GRCm39)	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	82,920,676 (GRCm39)	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	82,920,869 (GRCm39)	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	82,921,168 (GRCm39)	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	82,926,511 (GRCm39)	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	82,919,756 (GRCm39)	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	82,919,955 (GRCm39)	unclassified	noncoding transcript
R4293:Slfn10-ps	UTSW	11	82,926,260 (GRCm39)	unclassified	noncoding transcript
R4929:Slfn10-ps	UTSW	11	82,920,345 (GRCm39)	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	82,921,207 (GRCm39)	unclassified	noncoding transcript
R5083:Slfn10-ps	UTSW	11	82,921,341 (GRCm39)	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	82,919,851 (GRCm39)	unclassified	noncoding transcript
R5306:Slfn10-ps	UTSW	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
R5444:Slfn10-ps	UTSW	11	82,926,113 (GRCm39)	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- CCATGAAATGGGAGCCTCTGAGAAC -3'
(R):5'- TGCAGTCCTACTGATGACAGAGCC -3'

Sequencing Primer
(F):5'- CAGCAGAAAGGCTCTACTTTG -3'
(R):5'- TGATGACAGAGCCAATAAAATTCCAG -3'

Posted On

2013-05-09