Incidental Mutation 'R0069:Ifi206'
ID33081
Institutional Source Beutler Lab
Gene Symbol Ifi206
Ensembl Gene ENSMUSG00000037849
Gene Nameinterferon activated gene 206
SynonymsGm4955, Pyblhin-C
MMRRC Submission 038360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0069 (G1)
Quality Score220
Status Validated (trace)
Chromosome1
Chromosomal Location173468485-173491041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173486847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 9 (V9D)
Ref Sequence ENSEMBL: ENSMUSP00000134646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160565]
Predicted Effect probably damaging
Transcript: ENSMUST00000160565
AA Change: V9D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849
AA Change: V9D

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Meta Mutation Damage Score 0.7824 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,561,562 C632S probably damaging Het
Antxr2 T A 5: 97,948,250 M392L possibly damaging Het
Cd101 A G 3: 101,008,217 V678A probably benign Het
Clec2g T A 6: 128,948,753 S42T probably benign Het
Clec2g T C 6: 128,980,311 probably null Het
Creb1 A G 1: 64,576,208 I240V possibly damaging Het
D2hgdh G T 1: 93,835,287 V265L possibly damaging Het
Dctn2 A T 10: 127,277,485 probably null Het
Diablo A T 5: 123,518,024 S117R probably damaging Het
Ebf2 A T 14: 67,410,050 R349S probably damaging Het
Fam168a C T 7: 100,835,411 A252V probably benign Het
Fbn2 T C 18: 58,069,184 Y1299C probably damaging Het
Gne A C 4: 44,060,099 V98G probably damaging Het
Hk2 A G 6: 82,736,528 probably null Het
Ints3 A G 3: 90,400,647 probably benign Het
Itgal A G 7: 127,310,331 T56A probably benign Het
Lzts3 T A 2: 130,636,540 T213S probably benign Het
Map1b A G 13: 99,429,848 S2122P unknown Het
Mei4 C T 9: 82,025,582 Q223* probably null Het
Mpzl3 T C 9: 45,068,252 V167A probably damaging Het
Myo1d A G 11: 80,637,953 I681T probably damaging Het
Myom2 A G 8: 15,117,624 T1070A probably benign Het
Nacc1 T A 8: 84,677,199 I16F probably damaging Het
Nfx1 T C 4: 40,986,688 probably benign Het
Olfr1335 A T 4: 118,809,690 V58D probably damaging Het
Olfr952 A G 9: 39,426,892 Y60H probably damaging Het
Ostm1 A C 10: 42,692,956 D37A probably benign Het
Pde8a T C 7: 81,319,123 probably benign Het
Pole2 A T 12: 69,209,887 V288E probably damaging Het
Poteg T C 8: 27,447,821 S2P probably benign Het
Ppp2r5c A T 12: 110,567,770 M356L probably benign Het
Prkdc G A 16: 15,726,504 S1786N probably benign Het
Prox1 A G 1: 190,160,919 V443A possibly damaging Het
Prpf6 T A 2: 181,615,963 probably null Het
Ptger1 A T 8: 83,668,319 T142S possibly damaging Het
Rad54l2 C A 9: 106,710,365 V734L possibly damaging Het
Rnpepl1 T A 1: 92,918,898 N507K possibly damaging Het
Slc38a10 A T 11: 120,106,502 V722E probably damaging Het
Slfn10-ps A G 11: 83,035,542 noncoding transcript Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sult1e1 A T 5: 87,579,897 H175Q probably damaging Het
Ube2e3 C A 2: 78,919,949 probably benign Het
Vmn1r208 A T 13: 22,772,425 W301R probably benign Het
Vps13d A G 4: 145,062,563 I746T probably benign Het
Xpnpep3 T C 15: 81,430,798 V233A probably benign Het
Zfp329 A T 7: 12,810,932 S222T probably damaging Het
Zswim6 T C 13: 107,738,563 noncoding transcript Het
Other mutations in Ifi206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Ifi206 APN 1 173485576 missense probably benign 0.00
IGL02044:Ifi206 APN 1 173480991 missense probably benign 0.41
IGL02118:Ifi206 APN 1 173481768 missense probably benign 0.05
IGL02476:Ifi206 APN 1 173481566 missense probably benign 0.02
IGL02824:Ifi206 APN 1 173481872 missense possibly damaging 0.95
IGL03375:Ifi206 APN 1 173480778 missense probably benign 0.06
PIT4142001:Ifi206 UTSW 1 173481164 missense probably benign 0.02
R0741:Ifi206 UTSW 1 173473749 missense probably benign 0.41
R1572:Ifi206 UTSW 1 173486853 missense probably benign 0.10
R1742:Ifi206 UTSW 1 173481971 missense probably benign 0.06
R4109:Ifi206 UTSW 1 173480988 missense probably benign 0.00
R4707:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4783:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4785:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4805:Ifi206 UTSW 1 173481386 missense possibly damaging 0.55
R4918:Ifi206 UTSW 1 173482044 missense possibly damaging 0.73
R5043:Ifi206 UTSW 1 173486718 missense probably damaging 1.00
R5080:Ifi206 UTSW 1 173473848 missense possibly damaging 0.61
R5419:Ifi206 UTSW 1 173481231 missense probably benign 0.05
R5420:Ifi206 UTSW 1 173481033 missense possibly damaging 0.84
R5777:Ifi206 UTSW 1 173481362 missense possibly damaging 0.55
R5988:Ifi206 UTSW 1 173481340 missense possibly damaging 0.90
R6772:Ifi206 UTSW 1 173481207 missense unknown
R6782:Ifi206 UTSW 1 173481357 missense unknown
R6806:Ifi206 UTSW 1 173481571 missense probably benign 0.06
R7042:Ifi206 UTSW 1 173481242 missense
R7091:Ifi206 UTSW 1 173473875 missense unknown
R7292:Ifi206 UTSW 1 173473862 missense unknown
R7429:Ifi206 UTSW 1 173480591 missense
R7499:Ifi206 UTSW 1 173482041 missense
R7772:Ifi206 UTSW 1 173481074 missense
R7853:Ifi206 UTSW 1 173471534 nonsense probably null
R7971:Ifi206 UTSW 1 173471410 missense unknown
R8079:Ifi206 UTSW 1 173481158 missense
R8390:Ifi206 UTSW 1 173480945 missense
R8500:Ifi206 UTSW 1 173486745 missense
R8712:Ifi206 UTSW 1 173480508 missense
R8753:Ifi206 UTSW 1 173473657 missense unknown
R8875:Ifi206 UTSW 1 173473787 missense unknown
X0052:Ifi206 UTSW 1 173481969 missense possibly damaging 0.89
Z1088:Ifi206 UTSW 1 173474011 missense probably damaging 1.00
Z1176:Ifi206 UTSW 1 173482048 missense
Predicted Primers PCR Primer
(F):5'- ACTGCAAGGAGCTGGCAAGTTTAG -3'
(R):5'- ACAGTGGCACAGTTAGTAAGCGATG -3'

Sequencing Primer
(F):5'- CAACATGATCTGCAAGTTCTGG -3'
(R):5'- AGTAAGCGATGCTCCATTTTTTC -3'
Posted On2013-05-09