Incidental Mutation 'R5083:Slfn10-ps'
ID500853
Institutional Source Beutler Lab
Gene Symbol Slfn10-ps
Ensembl Gene ENSMUSG00000072621
Gene Nameschlafen 10, pseudogene
Synonyms
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83028130-83040042 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 83030515 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100716
SMART Domains Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AlbA_2 142 278 1.3e-13 PFAM
Pfam:DUF2075 529 697 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152760
SMART Domains Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

DomainStartEndE-ValueType
Pfam:AAA_4 142 280 1.8e-14 PFAM
Pfam:DUF2075 529 693 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185158
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Slfn10-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slfn10-ps APN 11 83035529 unclassified noncoding transcript
IGL00826:Slfn10-ps APN 11 83035259 unclassified noncoding transcript
IGL01022:Slfn10-ps APN 11 83035527 unclassified noncoding transcript
IGL01409:Slfn10-ps APN 11 83035496 unclassified noncoding transcript
IGL01664:Slfn10-ps APN 11 83035935 unclassified noncoding transcript
IGL01700:Slfn10-ps APN 11 83029112 unclassified noncoding transcript
IGL02093:Slfn10-ps APN 11 83032190 unclassified noncoding transcript
IGL02253:Slfn10-ps APN 11 83029064 unclassified noncoding transcript
IGL02364:Slfn10-ps APN 11 83032291 unclassified noncoding transcript
IGL02466:Slfn10-ps APN 11 83030264 unclassified noncoding transcript
IGL02636:Slfn10-ps APN 11 83030145 unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 83030300 unclassified noncoding transcript
R0055:Slfn10-ps UTSW 11 83030300 unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 83035542 unclassified noncoding transcript
R0069:Slfn10-ps UTSW 11 83035542 unclassified noncoding transcript
R0164:Slfn10-ps UTSW 11 83035302 unclassified noncoding transcript
R0362:Slfn10-ps UTSW 11 83035774 unclassified noncoding transcript
R0382:Slfn10-ps UTSW 11 83029534 unclassified noncoding transcript
R0597:Slfn10-ps UTSW 11 83035653 unclassified noncoding transcript
R0812:Slfn10-ps UTSW 11 83035562 unclassified noncoding transcript
R0904:Slfn10-ps UTSW 11 83035409 unclassified noncoding transcript
R1552:Slfn10-ps UTSW 11 83029850 unclassified noncoding transcript
R1703:Slfn10-ps UTSW 11 83030043 unclassified noncoding transcript
R2127:Slfn10-ps UTSW 11 83030342 unclassified noncoding transcript
R2151:Slfn10-ps UTSW 11 83035685 unclassified noncoding transcript
R2302:Slfn10-ps UTSW 11 83028930 unclassified noncoding transcript
R3114:Slfn10-ps UTSW 11 83029129 unclassified noncoding transcript
R4293:Slfn10-ps UTSW 11 83035434 unclassified noncoding transcript
R4929:Slfn10-ps UTSW 11 83029519 unclassified noncoding transcript
R4970:Slfn10-ps UTSW 11 83030381 unclassified noncoding transcript
R5290:Slfn10-ps UTSW 11 83029025 unclassified noncoding transcript
R5306:Slfn10-ps UTSW 11 83035529 unclassified noncoding transcript
R5444:Slfn10-ps UTSW 11 83035287 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCTTCTCTTCCAGGTTCAGG -3'
(R):5'- CGTGCCATACTCAACTGGAC -3'

Sequencing Primer
(F):5'- TTCCAGGTTCAGGTCCACAG -3'
(R):5'- TTCTCGCGTTAGAAAATAAACAGGCG -3'
Posted On2017-12-01