Incidental Mutation 'R4478:Zfp282'
ID331352
Institutional Source Beutler Lab
Gene Symbol Zfp282
Ensembl Gene ENSMUSG00000025821
Gene Namezinc finger protein 282
SynonymsHUB1
MMRRC Submission 041735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4478 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47877204-47908485 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 47890696 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 269 (R269*)
Ref Sequence ENSEMBL: ENSMUSP00000053643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061890]
Predicted Effect probably null
Transcript: ENSMUST00000061890
AA Change: R269*
SMART Domains Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: R269*

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Pfam:DUF3669 98 168 1.8e-12 PFAM
KRAB 198 260 1.04e-21 SMART
internal_repeat_1 317 372 1.1e-13 PROSPERO
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 457 499 N/A INTRINSIC
ZnF_C2H2 514 536 8.94e-3 SMART
ZnF_C2H2 542 564 4.72e-2 SMART
ZnF_C2H2 570 592 1.04e-3 SMART
ZnF_C2H2 598 620 4.24e-4 SMART
ZnF_C2H2 626 648 1.06e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125957
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,975,860 probably null Het
Adam3 T C 8: 24,695,155 D509G probably benign Het
Ank1 C T 8: 23,120,578 T1379I probably benign Het
Ap1m2 A G 9: 21,298,213 V389A probably benign Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
Chd9 T C 8: 91,034,031 probably benign Het
Chp2 A G 7: 122,220,918 D97G probably benign Het
Cpne5 T C 17: 29,209,476 T118A probably damaging Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dag1 G C 9: 108,208,730 T404R probably damaging Het
Dnah3 T G 7: 120,071,863 H599P probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fabp9 T C 3: 10,197,106 Y30C probably damaging Het
Fnbp1 G A 2: 31,105,254 A56V probably damaging Het
Gm20498 T C 12: 81,489,216 probably benign Het
Hid1 G A 11: 115,361,655 A67V probably damaging Het
Il6ra T A 3: 89,890,290 Y90F probably damaging Het
Kcnk18 T C 19: 59,235,244 S274P probably damaging Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lrrk2 G A 15: 91,723,188 A585T probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo9b A T 8: 71,291,081 K262M probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1100 G T 2: 86,978,218 R193S probably benign Het
Olfr433 C T 1: 174,042,616 T222I probably benign Het
Olfr779 C T 10: 129,311,776 L90F possibly damaging Het
Plxna4 A T 6: 32,196,133 C1288S possibly damaging Het
Ptpn22 T C 3: 103,902,064 probably benign Het
Rab11fip3 C T 17: 26,016,083 E619K probably damaging Het
Robo2 C A 16: 74,015,873 R311L probably damaging Het
Sdad1 A G 5: 92,297,160 M315T probably damaging Het
Slc39a12 T A 2: 14,420,179 L407* probably null Het
Snap29 T C 16: 17,428,155 V213A probably benign Het
Stard7 T A 2: 127,284,259 L77Q probably damaging Het
Stat5b A G 11: 100,787,284 Y668H probably benign Het
Tgfb2 A G 1: 186,632,499 I266T probably damaging Het
Tmem87a C T 2: 120,369,343 W440* probably null Het
Tnr T A 1: 159,884,756 probably null Het
Ubl3 C T 5: 148,511,977 S18N probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r9 T C 5: 108,846,277 E502G probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Vwa8 T A 14: 78,868,801 D61E probably benign Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp1 A G 8: 111,670,543 R366G probably damaging Het
Other mutations in Zfp282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL00755:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL01402:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01404:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01484:Zfp282 APN 6 47890120 missense possibly damaging 0.76
IGL01560:Zfp282 APN 6 47880277 missense probably damaging 1.00
IGL02949:Zfp282 APN 6 47897914 missense probably damaging 1.00
FR4304:Zfp282 UTSW 6 47904797 small insertion probably benign
FR4589:Zfp282 UTSW 6 47904791 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904790 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904799 small insertion probably benign
FR4976:Zfp282 UTSW 6 47904790 small insertion probably benign
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0118:Zfp282 UTSW 6 47892932 missense probably benign 0.34
R0415:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
R0415:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
R0607:Zfp282 UTSW 6 47880369 missense probably damaging 1.00
R0710:Zfp282 UTSW 6 47880384 missense probably damaging 1.00
R0946:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R1054:Zfp282 UTSW 6 47904599 missense probably benign 0.00
R1401:Zfp282 UTSW 6 47890174 nonsense probably null
R1572:Zfp282 UTSW 6 47892867 missense probably damaging 1.00
R2016:Zfp282 UTSW 6 47897787 intron probably null
R2971:Zfp282 UTSW 6 47897932 splice site probably null
R4064:Zfp282 UTSW 6 47880094 missense probably damaging 0.99
R4530:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R4532:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R5068:Zfp282 UTSW 6 47877703 missense probably benign 0.01
R5261:Zfp282 UTSW 6 47897890 missense probably damaging 0.99
R5326:Zfp282 UTSW 6 47905327 missense probably benign
R5551:Zfp282 UTSW 6 47890645 missense possibly damaging 0.59
R6046:Zfp282 UTSW 6 47880168 missense probably damaging 1.00
R6408:Zfp282 UTSW 6 47880385 missense probably damaging 1.00
R7535:Zfp282 UTSW 6 47904944 missense probably benign 0.03
S24628:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
S24628:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
Z1177:Zfp282 UTSW 6 47890637 missense not run
Predicted Primers PCR Primer
(F):5'- ATAATGGCTGCCATGCTGTG -3'
(R):5'- GCATGTTCTGTAAGTGACCACAC -3'

Sequencing Primer
(F):5'- ACATTGGTAACTGAGAGCCCTGC -3'
(R):5'- ACAACAGCTGTGGTATAAGTGGTTC -3'
Posted On2015-07-21