Incidental Mutation 'R4480:Olfr330'
ID331438
Institutional Source Beutler Lab
Gene Symbol Olfr330
Ensembl Gene ENSMUSG00000050818
Gene Nameolfactory receptor 330
SynonymsMOR275-1, GA_x6K02T2NKPP-895420-896349
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58527186-58534836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58529801 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 62 (P62T)
Ref Sequence ENSEMBL: ENSMUSP00000149073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134055] [ENSMUST00000213188]
Predicted Effect probably damaging
Transcript: ENSMUST00000062869
AA Change: P62T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063194
Gene: ENSMUSG00000050818
AA Change: P62T

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117184
Predicted Effect probably damaging
Transcript: ENSMUST00000134055
AA Change: P62T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145126
Gene: ENSMUSG00000050818
AA Change: P62T

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203550
AA Change: P62T
SMART Domains Protein: ENSMUSP00000145138
Gene: ENSMUSG00000050818
AA Change: P62T

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 1.1e-13 PFAM
Pfam:7TM_GPCR_Srsx 39 130 1.3e-4 PFAM
Pfam:7tm_1 45 130 6.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213188
AA Change: P62T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.8359 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Olfr330
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Olfr330 APN 11 58529396 missense probably benign 0.17
IGL01672:Olfr330 APN 11 58529122 missense probably benign 0.43
IGL01782:Olfr330 APN 11 58529159 missense probably benign 0.03
IGL01998:Olfr330 APN 11 58529577 nonsense probably null
IGL02538:Olfr330 APN 11 58529990 utr 5 prime probably benign
R1670:Olfr330 UTSW 11 58529411 missense probably damaging 1.00
R1727:Olfr330 UTSW 11 58529516 missense possibly damaging 0.51
R1768:Olfr330 UTSW 11 58529776 missense probably damaging 1.00
R1839:Olfr330 UTSW 11 58529373 nonsense probably null
R2129:Olfr330 UTSW 11 58529611 missense probably damaging 1.00
R2135:Olfr330 UTSW 11 58529785 missense probably damaging 1.00
R2425:Olfr330 UTSW 11 58529311 missense probably damaging 1.00
R3753:Olfr330 UTSW 11 58529690 missense probably benign 0.00
R4827:Olfr330 UTSW 11 58529596 missense probably damaging 0.99
R4836:Olfr330 UTSW 11 58529482 missense probably damaging 0.99
R4973:Olfr330 UTSW 11 58529077 missense probably benign
R5128:Olfr330 UTSW 11 58529422 missense probably damaging 0.98
R5288:Olfr330 UTSW 11 58529482 missense probably damaging 0.99
R5326:Olfr330 UTSW 11 58529884 missense probably benign 0.02
R5542:Olfr330 UTSW 11 58529884 missense probably benign 0.02
R5620:Olfr330 UTSW 11 58529731 missense probably damaging 0.99
R6210:Olfr330 UTSW 11 58529264 missense probably damaging 1.00
R7163:Olfr330 UTSW 11 58529168 nonsense probably null
R7886:Olfr330 UTSW 11 58529054 missense probably benign 0.01
R7969:Olfr330 UTSW 11 58529054 missense probably benign 0.01
RF003:Olfr330 UTSW 11 58529157 frame shift probably null
RF004:Olfr330 UTSW 11 58529157 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATAGCGGTCGTAGGACATGG -3'
(R):5'- TCTTGGTTGCCTAGGAGACACC -3'

Sequencing Primer
(F):5'- TCGTAGGACATGGCAGCCAG -3'
(R):5'- TTGCCTAGGAGACACCCATGG -3'
Posted On2015-07-21