Incidental Mutation 'R4480:Olfr1510'
ID331444
Institutional Source Beutler Lab
Gene Symbol Olfr1510
Ensembl Gene ENSMUSG00000063106
Gene Nameolfactory receptor 1510
SynonymsGA_x6K02T2RJGY-583652-584608, MOR223-6
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4480 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location52409131-52414373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52410308 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 188 (A188V)
Ref Sequence ENSEMBL: ENSMUSP00000150294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079459] [ENSMUST00000215928]
Predicted Effect probably damaging
Transcript: ENSMUST00000079459
AA Change: A188V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078424
Gene: ENSMUSG00000063106
AA Change: A188V

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 8.1e-50 PFAM
Pfam:7tm_1 45 293 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206257
AA Change: A188V
Predicted Effect probably damaging
Transcript: ENSMUST00000215928
AA Change: A188V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Sostdc1 A G 12: 36,317,166 I114V probably damaging Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Olfr1510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Olfr1510 APN 14 52410842 missense probably benign 0.04
IGL02097:Olfr1510 APN 14 52410054 missense probably benign
R0282:Olfr1510 UTSW 14 52410263 missense possibly damaging 0.94
R1449:Olfr1510 UTSW 14 52410567 missense probably damaging 1.00
R2113:Olfr1510 UTSW 14 52410296 missense probably damaging 1.00
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2873:Olfr1510 UTSW 14 52410861 missense probably benign
R3409:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R3411:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R5292:Olfr1510 UTSW 14 52410445 missense possibly damaging 0.90
R5297:Olfr1510 UTSW 14 52410218 missense probably damaging 1.00
R5441:Olfr1510 UTSW 14 52409957 missense probably benign 0.02
R5749:Olfr1510 UTSW 14 52410504 missense probably damaging 1.00
R5872:Olfr1510 UTSW 14 52410768 missense probably damaging 1.00
R5941:Olfr1510 UTSW 14 52410068 missense probably benign 0.01
R7209:Olfr1510 UTSW 14 52410093 missense possibly damaging 0.80
R7379:Olfr1510 UTSW 14 52410261 missense probably benign 0.08
R7463:Olfr1510 UTSW 14 52410711 missense probably benign 0.00
R7692:Olfr1510 UTSW 14 52410488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGTGACCACAGTGAGATG -3'
(R):5'- TCTACACTTTGATGGCCTATGACAG -3'

Sequencing Primer
(F):5'- CCACAGTGAGATGGGAGCCAC -3'
(R):5'- ACAATCCTAGTGGCTGGA -3'
Posted On2015-07-21