Incidental Mutation 'R4480:Sostdc1'
ID331440
Institutional Source Beutler Lab
Gene Symbol Sostdc1
Ensembl Gene ENSMUSG00000036169
Gene Namesclerostin domain containing 1
Synonymsectodin, Wise, Sostl, USAG-1
MMRRC Submission 041737-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R4480 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location36314139-36318452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36317166 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 114 (I114V)
Ref Sequence ENSEMBL: ENSMUSP00000040230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041407]
Predicted Effect probably damaging
Transcript: ENSMUST00000041407
AA Change: I114V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040230
Gene: ENSMUSG00000036169
AA Change: I114V

DomainStartEndE-ValueType
Pfam:Sclerostin 6 206 2.1e-112 PFAM
Pfam:DAN 47 168 3.2e-17 PFAM
Pfam:Cys_knot 72 185 1.2e-7 PFAM
Meta Mutation Damage Score 0.1807 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sclerostin family and encodes an N-glycosylated, secreted protein with a C-terminal cystine knot-like domain. This protein functions as a bone morphogenetic protein (BMP) antagonist. Specifically, it directly associates with BMPs, prohibiting them from binding their receptors, thereby regulating BMP signaling during cellular proliferation, differentiation, and programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause variable defects in many aspects of tooth development, including tooth number, size and cusp pattern. Observed phenotypes may include cranial and palatal defects, neonatal death, altered trigeminal ganglion morphology, and resistance to cisplatin-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,005,239 T553A possibly damaging Het
Adgrb3 A T 1: 25,111,748 F1135I probably damaging Het
Arfgef3 A T 10: 18,600,600 F1490L probably damaging Het
Begain A G 12: 109,034,123 Y446H probably damaging Het
Cdh15 A G 8: 122,864,676 H517R probably benign Het
D130040H23Rik C A 8: 69,302,503 H187N possibly damaging Het
Dip2b C T 15: 100,186,301 T935M probably damaging Het
Eif2s2 T C 2: 154,888,270 T36A probably benign Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxo10 T C 4: 45,048,470 Y555C probably damaging Het
Fpr2 C T 17: 17,893,753 T337I probably benign Het
Frem3 A T 8: 80,611,357 Q93L probably benign Het
Gapdh A G 6: 125,163,182 V119A possibly damaging Het
Gm3159 T C 14: 4,398,584 Y92H probably damaging Het
Hkdc1 T C 10: 62,391,372 I769V probably benign Het
Ifne T C 4: 88,879,601 *193W probably null Het
Katna1 T C 10: 7,738,830 V32A probably damaging Het
Nup107 T C 10: 117,761,332 I673V probably benign Het
Nup188 T A 2: 30,322,129 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1510 G A 14: 52,410,308 A188V probably damaging Het
Olfr330 G T 11: 58,529,801 P62T probably damaging Het
Pcdhb5 T A 18: 37,320,752 S62T probably benign Het
Plekha5 T C 6: 140,526,479 V44A probably damaging Het
Psg18 C T 7: 18,350,862 S103N probably benign Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Ptprs A G 17: 56,426,404 V804A possibly damaging Het
Rab35 C A 5: 115,637,764 S34* probably null Het
Slco6d1 T A 1: 98,507,574 Y671* probably null Het
Tecta A G 9: 42,373,233 F852S possibly damaging Het
Tmem179 T C 12: 112,503,303 E21G probably benign Het
Tmem2 A G 19: 21,815,489 Q703R probably benign Het
Usp17la T A 7: 104,860,690 H167Q probably benign Het
Vps8 A T 16: 21,545,236 probably benign Het
Wdr17 A G 8: 54,664,964 probably null Het
Wdr73 T C 7: 80,893,221 E213G probably benign Het
Zfp985 A G 4: 147,584,079 D468G probably benign Het
Other mutations in Sostdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Sostdc1 APN 12 36317122 missense probably damaging 1.00
R0588:Sostdc1 UTSW 12 36317021 splice site probably benign
R0671:Sostdc1 UTSW 12 36317341 missense probably damaging 0.99
R2184:Sostdc1 UTSW 12 36317296 missense probably damaging 0.97
R4320:Sostdc1 UTSW 12 36317420 missense probably benign 0.04
R5511:Sostdc1 UTSW 12 36317166 missense probably damaging 1.00
R5589:Sostdc1 UTSW 12 36317247 nonsense probably null
R5665:Sostdc1 UTSW 12 36314408 missense probably benign 0.39
R6453:Sostdc1 UTSW 12 36314408 missense probably benign 0.39
R6752:Sostdc1 UTSW 12 36314412 missense probably benign 0.00
R7232:Sostdc1 UTSW 12 36317311 missense possibly damaging 0.87
R8810:Sostdc1 UTSW 12 36317230 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTCCCTGATGCAGTTCTGTC -3'
(R):5'- AGCTCAGACTGTGCTTGCTG -3'

Sequencing Primer
(F):5'- CCTGTTTCCTGCAGGTCGAG -3'
(R):5'- ACACGCTTTCAAAGTTGTGGC -3'
Posted On2015-07-21